Morpholino
MO3-tnnt2a
- ID
- ZDB-MRPHLNO-110616-1
- Name
- MO3-tnnt2a
- Previous Names
-
- TNNT2sp (1)
- Target
- Sequence
-
5' - TAGACACAGATGAACTCACAATTTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-tnnt2a
No data available
Phenotype
Phenotype resulting from MO3-tnnt2a
1 - 5 of 11 Show all
Phenotype of all Fish created by or utilizing MO3-tnnt2a
1 - 5 of 11 Show all
Citations
- Li, H., Luo, Q., Cai, S., Tie, R., Meng, Y., Shan, W., Xu, Y., Zeng, X., Qian, P., Huang, H. (2023) Glia maturation factor-γ is required for initiation and maintenance of hematopoietic stem and progenitor cells. Stem Cell Research & Therapy. 14:117117
- Becker, J.R., Robinson, T.Y., Sachidanandan, C., Kelly, A.E., Coy, S., Peterson, R.T., and MacRae, C.A. (2012) In vivo natriuretic peptide reporter assay identifies chemical modifiers of hypertrophic cardiomyopathy signaling. Cardiovascular research. 93(3):463-470
- Becker, J.R., Deo, R.C., Werdich, A.A., Panàkovà, D., Coy, S., and MacRae, C.A. (2011) Human cardiomyopathy mutations induce myocyte hyperplasia and activate hypertrophic pathways during cardiogenesis in zebrafish. Disease models & mechanisms. 4(3):400-410
1 - 3 of 3
Show