Morpholino
MO1-bmp2a
- ID
- ZDB-MRPHLNO-110614-1
- Name
- MO1-bmp2a
- Previous Names
- None
- Target
- Sequence
-
5' - TGGACGAGACCATGATGATCTCTGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bmp2a
No data available
Phenotype
Phenotype resulting from MO1-bmp2a
| Phenotype | Fish | Figures |
|---|---|---|
| epiphysis has fewer parts of type photoreceptor cell, abnormal | y8Tg + MO1-bmp2a |
Fig. 2 
from Quillien et al., 2011 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-bmp2a
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| epiphysis has fewer parts of type photoreceptor cell, abnormal | y8Tg + MO1-bmp2a | standard conditions |
Fig. 2
from Quillien et al., 2011 |
1 - 1 of 1
Citations
- Bowley, G., Irving, S., Hoefer, I., Wilkinson, R., Pasterkamp, G., Darwish, H.M.S., White, S., Francis, S.E., Chico, T., Noel, E., Serbanovic-Canic, J., Evans, P.C. (2024) Zebrafish model for functional screening of flow-responsive genes controlling endothelial cell proliferation. Scientific Reports. 14:3013030130
- Quillien, A., Blanco-Sanchez, B., Halluin, C., Moore, J.C., Lawson, N.D., Blader, P., and Cau, E. (2011) BMP signaling orchestrates photoreceptor specification in the zebrafish pineal gland in collaboration with Notch. Development (Cambridge, England). 138(11):2293-2302
1 - 2 of 2
Show