Morpholino
MO1-ncor2
- ID
- ZDB-MRPHLNO-110607-3
- Name
- MO1-ncor2
- Previous Names
- None
- Target
- Sequence
-
5' - GTTATTCTGCGAGCACAGAAAATCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ncor2
No data available
Phenotype
Phenotype resulting from MO1-ncor2
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO1-ncor2
1 - 5 of 10 Show all
Citations
- Jung, H.M., Hu, C.T., Fister, A.M., Davis, A.E., Castranova, D., Pham, V.N., Price, L.M., Weinstein, B.M. (2019) MicroRNA-mediated control of developmental lymphangiogenesis. eLIFE. 8:
- Wei, Y., Ma, D., Gao, Y., Zhang, C., Wang, L., Liu, F. (2014) Ncor2 is required for hematopoietic stem cell emergence by inhibiting Fos signaling in zebrafish. Blood. 124(10):1578-85
- Tijssen, M.R., Cvejic, A., Joshi, A., Hannah, R.L., Ferreira, R., Forrai, A., Bellissimo, D.C., Oram, S.H., Smethurst, P.A., Wilson, N.K., Wang, X., Ottersbach, K., Stemple, D.L., Green, A.R., Ouwehand, W.H., and Göttgens, B. (2011) Genome-wide Analysis of Simultaneous GATA1/2, RUNX1, FLI1, and SCL Binding in Megakaryocytes Identifies Hematopoietic Regulators. Developmental Cell. 20(5):597-609
1 - 3 of 3
Show