Morpholino
MO3-itgb1b
- ID
- ZDB-MRPHLNO-101103-2
- Name
- MO3-itgb1b
- Previous Names
-
- β1bEl10 (1)
- Target
- Sequence
-
5' - GCCAGTTTGAGTGAATAACTCACCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-itgb1b
No data available
Phenotype
Phenotype resulting from MO3-itgb1b
1 - 5 of 18 Show all
Phenotype of all Fish created by or utilizing MO3-itgb1b
1 - 5 of 22 Show all
Citations
- Renz, M., Otten, C., Faurobert, E., Rudolph, F., Zhu, Y., Boulday, G., Duchene, J., Mickoleit, M., Dietrich, A.C., Ramspacher, C., Steed, E., Manet-Dupé, S., Benz, A., Hassel, D., Vermot, J., Huisken, J., Tournier-Lasserve, E., Felbor, U., Sure, U., Albiges-Rizo, C., Abdelilah-Seyfried, S. (2015) Regulation of β1 Integrin-Klf2-Mediated Angiogenesis by CCM Proteins. Developmental Cell. 32:181-190
- Gao, W., Xu, L., Guan, R., Liu, X., Han, Y., Wu, Q., Xiao, Y., Qi, F., Zhu, Z., Lin, S., and Zhang, B. (2011) Wdr18 Is Required for Kupffer's Vesicle Formation and Regulation of Body Asymmetry in Zebrafish. PLoS One. 6(8):e23386
- Ablooglu, A.J., Tkachenko, E., Kang, J., and Shattil, S.J. (2010) Integrin alphaV is necessary for gastrulation movements that regulate vertebrate body asymmetry. Development (Cambridge, England). 137(20):3449-3458
1 - 3 of 3
Show