Morpholino
MO9-runx1
- ID
- ZDB-MRPHLNO-100813-4
- Name
- MO9-runx1
- Previous Names
-
- runx1 runt domain MO (1)
- Target
- Sequence
-
5' - TTTTCAGCATCTCACCTCGTCCGCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO9-runx1
No data available
Phenotype
Phenotype resulting from MO9-runx1
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO9-runx1
1 - 5 of 10 Show all
Citations
- Li, D., Xue, W., Li, M., Dong, M., Wang, J., Wang, X., Li, X., Chen, K., Zhang, W., Wu, S., Zhang, Y., Gao, L., Chen, Y., Chen, J., Zhou, B.O., Zhou, Y., Yao, X., Li, L., Wu, D., Pan, W. (2018) VCAM-1+ macrophages guide the homing of HSPCs to a vascular niche. Nature. 564(7734):119-124
- Hall, C.J., Flores, M.V., Oehlers, S.H., Sanderson, L.E., Lam, E.Y., Crosier, K.E., and Crosier, P.S. (2012) Infection-Responsive Expansion of the Hematopoietic Stem and Progenitor Cell Compartment in Zebrafish Is Dependent upon Inducible Nitric Oxide. Cell Stem Cell. 10(2):198-209
- Lam, E.Y., Hall, C.J., Crosier, P.S., Crosier, K.E., and Flores, M.V. (2010) Live imaging of Runx1 expression in the dorsal aorta tracks the emergence of blood progenitors from endothelial cells. Blood. 116(6):909-914
- Lam, E.Y., Chau, J.Y., Kalev-Zylinska, M.L., Fountaine, T.M., Mead, R.S., Hall, C.J., Crosier, P.S., Crosier, K.E., and Flores, M.V. (2009) Zebrafish runx1 promoter-EGFP transgenics mark discrete sites of definitive blood progenitors. Blood. 113(6):1241-1249
1 - 4 of 4
Show