Morpholino
MO1-scn5lab
- ID
- ZDB-MRPHLNO-100616-3
- Name
- MO1-scn5lab
- Previous Names
-
- AB-MO2 (1)
- MO1-scn12ab
- Target
- Sequence
-
5' - AGTTTGTGCTGACCGGTGGTCTGGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-scn5lab
No data available
Phenotype
Phenotype resulting from MO1-scn5lab
1 - 5 of 18 Show all
Phenotype of all Fish created by or utilizing MO1-scn5lab
1 - 5 of 44 Show all
Citations
- Chetaille, P., Preuss, C., Burkhard, S., Côté, J.M., Houde, C., Castilloux, J., Piché, J., Gosset, N., Leclerc, S., Wünnemann, F., Thibeault, M., Gagnon, C., Galli, A., Tuck, E., Hickson, G.R., Amine, N.E., Boufaied, I., Lemyre, E., de Santa Barbara, P., Faure, S., Jonzon, A., Cameron, M., Dietz, H.C., Gallo-McFarlane, E., Benson, D.W., Moreau, C., Labuda, D., FORGE Canada Consortium, Zhan, S.H., Shen, Y., Jomphe, M., Jones, S.J., Bakkers, J., Andelfinger, G. (2014) Mutations in SGOL1 cause a novel cohesinopathy affecting heart and gut rhythm. Nature Genetics. 46(11):1245-9
- Bennett, J., Stroud, D., Becker, J., and Roden, D. (2013) Proliferation of embryonic cardiomyocytes in zebrafish requires the sodium channel scn5Lab. Genesis (New York, N.Y. : 2000). 51(8):562-74
- Huttner, I.G., Trivedi, G., Jacoby, A., Mann, S.A., Vandenberg, J.I., and Fatkin, D. (2013) A transgenic zebrafish model of a human cardiac sodium channel mutation exhibits bradycardia, conduction-system abnormalities and early death. Journal of Molecular and Cellular Cardiology. 61:123-32
- Chopra, S.S., Stroud, D.M., Watanabe, H., Bennett, J.S., Burns, C.G., Wells, K.S., Yang, T., Zhong, T.P., and Roden, D.M. (2010) Voltage-Gated Sodium Channels Are Required for Heart Development in Zebrafish. Circulation research. 106(8):1342-1350
1 - 4 of 4
Show