Morpholino
MO1-itga3b
- ID
- ZDB-MRPHLNO-100528-10
- Name
- MO1-itga3b
- Previous Names
-
- itga3-ATG (1)
- Target
- Sequence
-
5' - GTGCAGAGACTTTCCGGCCATATTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
translation-blocker
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-itga3b
No data available
Phenotype
Phenotype resulting from MO1-itga3b
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-itga3b
1 - 5 of 11 Show all
Citations
- Williams, M.L.K., Sawada, A., Budine, T., Yin, C., Gontarz, P., Solnica-Krezel, L. (2018) Gon4l regulates notochord boundary formation and cell polarity underlying axis extension by repressing adhesion genes. Nature communications. 9:1319
- Nagendran, M., Arora, P., Gori, P., Mulay, A., Ray, S., Jacob, T., Sonawane, M. (2015) Canonical Wnt signalling regulates epithelial patterning by modulating levels of laminins in zebrafish appendages. Development (Cambridge, England). 142(2):320-30
- Postel, R., Margadant, C., Fischer, B., Kreft, M., Janssen, H., Secades, P., Zambruno, G., and Sonnenberg, A. (2013) Kindlin-1 mutant zebrafish as an in vivo model sytem to study adhesion mechanisms in the epidermis. The Journal of investigative dermatology. 133(9):2180-90
- Carney, T.J., Feitosa, N.M., Sonntag, C., Slanchev, K., Kluger, J., Kiyozumi, D., Gebauer, J.M., Coffin Talbot, J., Kimmel, C.B., Sekiguchi, K., Wagener, R., Schwarz, H., Ingham, P.W., and Hammerschmidt, M. (2010) Genetic analysis of fin development in zebrafish identifies furin and hemicentin1 as potential novel Fraser Syndrome disease genes. PLoS Genetics. 6(4):e1000907
1 - 4 of 4
Show