Morpholino
MO1-sema3e
- ID
- ZDB-MRPHLNO-100510-4
- Name
- MO1-sema3e
- Previous Names
- None
- Target
- Sequence
-
5' - TGAAAGTCCACACACCCCACGCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sema3e
No data available
Phenotype
Phenotype resulting from MO1-sema3e
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-sema3e
1 - 4 of 4
Citations
- Jiang, Q., Arnold, S., Heanue, T., Kilambi, K.P., Doan, B., Kapoor, A., Ling, A.Y., Sosa, M.X., Guy, M., Jiang, Q., Burzynski, G., West, K., Bessling, S., Griseri, P., Amiel, J., Fernandez, R.M., Verheij, J.B., Hofstra, R.M., Borrego, S., Lyonnet, S., Ceccherini, I., Gray, J.J., Pachnis, V., McCallion, A.S., Chakravarti, A. (2015) Functional Loss of Semaphorin 3C and/or Semaphorin 3D and Their Epistatic Interaction with Ret Are Critical to Hirschsprung Disease Liability. American journal of human genetics. 96:581-596
- Lamont, R.E., Lamont, E.J., and Childs, S.J. (2009) Antagonistic interactions among Plexins regulate the timing of intersegmental vessel formation. Developmental Biology. 331(2):199-209
1 - 2 of 2
Show