Morpholino
MO1-nos1
- ID
- ZDB-MRPHLNO-100503-12
- Name
- MO1-nos1
- Previous Names
- None
- Target
- Sequence
-
5' - ACGCTGGGCTCTGATTCCTGCATTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nos1
No data available
Phenotype
Phenotype resulting from MO1-nos1
1 - 5 of 9 Show all
Phenotype of all Fish created by or utilizing MO1-nos1
1 - 5 of 12 Show all
Citations
- Porteus, C.S., Pollack, J., Tzaneva, V., Kwong, R.W., Kumai, Y., Abdallah, S.J., Zaccone, G., Lauriano, E.R., Milsom, W.K., Perry, S.F. (2015) A role for nitric oxide in the control of breathing in zebrafish (Danio rerio). The Journal of experimental biology. 218(Pt 23):3746-53
- Cox, A.G., Saunders, D.C., Kelsey, P.B., Conway, A.A., Tesmenitsky, Y., Marchini, J.F., Brown, K.K., Stamler, J.S., Colagiovanni, D.B., Rosenthal, G.J., Croce, K.J., North, T.E., and Goessling, W. (2014) S-Nitrosothiol Signaling Regulates Liver Development and Improves Outcome following Toxic Liver Injury. Cell Reports. 6(1):56-69
- Bradley, S., Tossell, K., Lockley, R., and McDearmid, J.R. (2010) Nitric oxide synthase regulates morphogenesis of zebrafish spinal cord motoneurons. The Journal of neuroscience : the official journal of the Society for Neuroscience. 30(50):16818-16831
- North, T.E., Goessling, W., Peeters, M., Li, P., Ceol, C., Lord, A.M., Weber, G.J., Harris, J., Cutting, C.C., Huang, P., Dzierzak, E., and Zon, L.I. (2009) Hematopoietic stem cell development is dependent on blood flow. Cell. 137(4):736-748
1 - 4 of 4
Show