Morpholino
MO5-ackr3b
- ID
- ZDB-MRPHLNO-100427-5
- Name
- MO5-ackr3b
- Previous Names
-
- MO5-cxcr7b
- cxcr7b MO2 (1)
- Target
- Sequence
-
5' - CCGTCTTTGTTATCGTCAACACTTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-ackr3b
No data available
Phenotype
Phenotype resulting from MO5-ackr3b
Phenotype | Fish | Figures |
---|---|---|
posterior lateral line neuromast primordium migration disrupted, abnormal | zf106Tg + MO5-ackr3b |
Fig. 2 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO5-ackr3b
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
posterior lateral line neuromast primordium migration disrupted, abnormal | zf106Tg + MO5-ackr3b | standard conditions |
Fig. 2 ![]() |
1 - 1 of 1
Citations
- Breau, M.A., Wilson, D., Wilkinson, D.G., and Xu, Q. (2012) Chemokine and Fgf signalling act as opposing guidance cues in formation of the lateral line primordium. Development (Cambridge, England). 139(12):2246-2253
- Cubedo, N., Cerdan, E., Sapede, D., and Rossel, M. (2009) CXCR4 and CXCR7 cooperate during tangential migration of facial motoneurons. Molecular and cellular neurosciences. 40(4):474-484
- Valentin, G., Haas, P., and Gilmour, D. (2007) The chemokine SDF1a coordinates tissue migration through the spatially restricted activation of Cxcr7 and Cxcr4b. Current biology : CB. 17(12):1026-1031
1 - 3 of 3
Show