Morpholino
MO1-ifng1
- ID
- ZDB-MRPHLNO-100415-13
- Name
- MO1-ifng1
- Previous Names
-
- MO1-ifng1-2
- ifngamma1-2-MO1 (1)
- Target
- Sequence
-
5' - TGAAGGCGTTCGCTAAAGTTAGAGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets the 5' UTR of ifng1-2.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ifng1
No data available
Phenotype
Phenotype resulting from MO1-ifng1
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-ifng1
1 - 5 of 12 Show all
Citations
- Chen, S.N., Gan, Z., Hou, J., Yang, Y.C., Huang, L., Huang, B., Wang, S., Nie, P. (2022) Identification and establishment of type IV interferon and the characterization of interferon-υ including its class II cytokine receptors IFN-υR1 and IL-10R2. Nature communications. 13:999
- Levitte, S., Adams, K.N., Berg, R.D., Cosma, C.L., Urdahl, K.B., Ramakrishnan, L. (2016) Mycobacterial Acid Tolerance Enables Phagolysosomal Survival and Establishment of Tuberculous Infection In Vivo. Cell Host & Microbe. 20:250-258
- Li, Y., Esain, V., Teng, L., Xu, J., Kwan, W., Frost, I.M., Yzaguirre, A.D., Cai, X., Cortes, M., Maijenburg, M.W., Tober, J., Dzierzak, E., Orkin, S.H., Tan, K., North, T.E., Speck, N.A. (2014) Inflammatory signaling regulates embryonic hematopoietic stem and progenitor cell production. Genes & Development. 28(23):2597-612
- Sawamiphak, S., Kontarakis, Z., Stainier, D.Y. (2014) Interferon Gamma Signaling Positively Regulates Hematopoietic Stem Cell Emergence. Developmental Cell. 31:640-653
- Aggad, D., Stein, C., Sieger, D., Mazel, M., Boudinot, P., Herbomel, P., Levraud, J.P., Lutfalla, G., and Leptin, M. (2010) In Vivo Analysis of Ifn-γ1 and Ifn-γ2 Signaling in Zebrafish. Journal of immunology (Baltimore, Md. : 1950). 185(11):6774-6782
- Sieger, D., Stein, C., Neifer, D., van der Sar, A.M., and Leptin, M. (2009) The role of gamma interferon in innate immunity in the zebrafish embryo. Disease models & mechanisms. 2(11-12):571-581
1 - 6 of 6
Show