Morpholino
MO1-arl13b
- ID
- ZDB-MRPHLNO-100113-3
- Name
- MO1-arl13b
- Previous Names
-
- hi459 oligo 2 (1)
- Target
- Sequence
-
5' - TTTCCCCCCTAAATGCTTTCACTGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
translation-blocker
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-arl13b
No data available
Phenotype
Phenotype resulting from MO1-arl13b
1 - 5 of 27 Show all
Phenotype of all Fish created by or utilizing MO1-arl13b
1 - 5 of 44 Show all
Citations
- Zhu, J., Wang, H.T., Chen, Y.R., Yan, L.Y., Han, Y.Y., Liu, L.Y., Cao, Y., Liu, Z.Z., Xu, H.A. (2020) The Joubert Syndrome Gene arl13b is Critical for Early Cerebellar Development in Zebrafish. Neuroscience Bulletin. 36(9):1023-1034
- Jin, M., Wang, D., Xu, W., Wang, H., Cao, Y. (2019) Claudin-7b and Claudin-h are required for controlling cilia morphogenesis in the zebrafish kidney. Mechanisms of Development. 161:103595
- Seixas, C., Choi, S.Y., Polgar, N., Umberger, N.L., East, M.P., Zuo, X., Moreiras, H., Ghossoub, R., Benmerah, A., Kahn, R.A., Fogelgren, B., Caspary, T., Lipschutz, J.H., Barral, D.C. (2016) Arl13b and the exocyst interact synergistically in ciliogenesis. Molecular biology of the cell. 27(2):308-20
- He, L., Xu, W., Jing, Y., Wu, M., Song, S., Cao, Y., Mei, C. (2015) Yes-Associated Protein (Yap) Is Necessary for Ciliogenesis and Morphogenesis during Pronephros Development in Zebrafish (Danio Rerio). International journal of biological sciences. 11:935-47
- Lu, H., Toh, M.T., Narasimhan, V., Thamilselvam, S.K., Choksi, S.P., Roy, S. (2015) A function for the Joubert syndrome protein Arl13b in ciliary membrane extension and ciliary length regulation. Developmental Biology. 397(2):225-36
- Casalou, C., Seixas, C., Portelinha, A., Pintado, P., Barros, M., Ramalho, J.S., Lopes, S.S., Barral, D.C. (2014) Arl13b and the non-muscle myosin heavy chain IIA are required for circular dorsal ruffle formation and cell migration. Journal of Cell Science. 127(Pt 12):2709-22
- Duldulao, N.A., Lee, S., and Sun, Z. (2009) Cilia localization is essential for in vivo functions of the Joubert syndrome protein Arl13b/Scorpion. Development (Cambridge, England). 136(23):4033-4042
- Sun, Z., Amsterdam, A., Pazour, G.J., Cole, D.G., Miller, M.S. and Hopkins, N. (2004) A Genetic Screen in Zebrafish Identifies Cilia Genes as a Principal Cause of Cystic Kidney Development. Development (Cambridge, England). 131(16):4085-4093
1 - 8 of 8
Show