Morpholino
MO1-duox
- ID
- ZDB-MRPHLNO-091117-1
- Name
- MO1-duox
- Previous Names
-
- MO1-duox1
- Target
- Sequence
-
5' - AGTGAATTAGAGAAATGCACCTTTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-duox
No data available
Phenotype
Phenotype resulting from MO1-duox
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-duox
1 - 5 of 31 Show all
Citations
- Cadiz Diaz, A., Schmidt, N.A., Yamazaki, M., Hsieh, C.J., Lisse, T.S., Rieger, S. (2022) Coordinated NADPH oxidase/hydrogen peroxide functions regulate cutaneous sensory axon de- and regeneration. Proceedings of the National Academy of Sciences of the United States of America. 119:e2115009119
- Ma, J., Scott, C.A., Ho, Y.N., Mahabaleshwar, H., Marsay, K.S., Zhang, C., Teow, C.K., Ng, S.S., Zhang, W., Tergaonkar, V., Partridge, L.J., Roy, S., Amaya, E., Carney, T.J. (2021) Matriptase activation of Gq drives epithelial disruption and inflammation via RSK and DUOX. eLIFE. 10:
- Bernut, A., Loynes, C.A., Floto, R.A., Renshaw, S.A. (2020) Deletion of cftr Leads to an Excessive Neutrophilic Response and Defective Tissue Repair in a Zebrafish Model of Sterile Inflammation. Frontiers in immunology. 11:1733
- Katikaneni, A., Jelcic, M., Gerlach, G.F., Ma, Y., Overholtzer, M., Niethammer, P. (2020) Lipid peroxidation regulates long-range wound detection through 5-lipoxygenase in zebrafish. Nature cell biology. 22(9):1049-1055
- Chen, J., Yu, T., He, X., Fu, Y., Dai, L., Wang, B., Wu, Y., He, J., Li, Y., Zhang, F., Zhao, J., Liu, C. (2019) Dual roles of hydrogen peroxide in promoting zebrafish renal repair and regeneration. Biochemical and Biophysical Research Communications. 516(3):680-685
- LeBert, D., Squirrell, J.M., Freisinger, C., Rindy, J., Golenberg, N., Frecentes, G., Gibson, A., Eliceiri, K.W., Huttenlocher, A. (2018) Damage-induced reactive oxygen species regulate vimentin and dynamic collagen-based projections to mediate wound repair.. eLIFE. 7:e30703
- Mendieta-Serrano, M.A., Mendez-Cruz, F.J., Antúnez-Mojica, M., Schnabel, D., Alvarez, L., Cárdenas, L., Lomelí, H., Ruiz-Santiesteban, J.A., Salas-Vidal, E. (2018) NADPH-Oxidase-derived reactive oxygen species are required for cytoskeletal organization, proper localization of E-cadherin and cell motility during zebrafish epiboly. Free radical biology & medicine. 130:82-98
- de Oliveira, S., Boudinot, P., Calado, Â., Mulero, V. (2015) Duox1-Derived H2O2 Modulates Cxcl8 Expression and Neutrophil Recruitment via JNK/c-JUN/AP-1 Signaling and Chromatin Modifications. Journal of immunology (Baltimore, Md. : 1950). 194(4):1523-33
- Candel, S., de Oliveira, S., López-Muñoz, A., García-Moreno, D., Espín-Palazón, R., Tyrkalska, S.D., Cayuela, M.L., Renshaw, S.A., Corbalán-Vélez, R., Vidal-Abarca, I., Tsai, H.J., Meseguer, J., Sepulcre, M.P., Mulero, V. (2014) Tnfa signaling through tnfr2 protects skin against oxidative stress-induced inflammation. PLoS Biology. 12:e1001855
- de Oliveira, S., López-Muñoz, A., Candel, S., Pelegrín, P., Calado, A., Mulero, V. (2014) ATP Modulates Acute Inflammation In Vivo through Dual Oxidase 1-Derived H2O2 Production and NF-kappaB Activation. Journal of immunology (Baltimore, Md. : 1950). 192(12):5710-9
1 - 10 of 19
Show