Morpholino
MO4-wnt5b
- ID
- ZDB-MRPHLNO-090915-1
- Name
- MO4-wnt5b
- Previous Names
-
- wnt5 MO (1)
- Target
- Sequence
-
5' - GCAAACACAATAATTTCTTACCACC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-wnt5b
No data available
Phenotype
Phenotype resulting from MO4-wnt5b
1 - 5 of 13 Show all
Phenotype of all Fish created by or utilizing MO4-wnt5b
1 - 5 of 21 Show all
Citations
- Hu, B., Rodriguez, J.J., Kakkerla Balaraju, A., Gao, Y., Nguyen, N.T., Steen, H., Suhaib, S., Chen, S., Lin, F. (2021) Glypican 4 mediates Wnt transport between germ layers via signaling filopodia. The Journal of cell biology. 220(12):
- Freisinger, C.M., Fisher, R.A., and Slusarski, D.C. (2010) Regulator of g protein signaling 3 modulates wnt5b calcium dynamics and somite patterning. PLoS Genetics. 6(7):e1001020
- Lin, S., Baye, L.M., Westfall, T.A., and Slusarski, D.C. (2010) Wnt5b-Ryk pathway provides directional signals to regulate gastrulation movement. The Journal of cell biology. 190(2):263-278
- Cirone, P., Lin, S., Griesbach, H.L., Zhang, Y., Slusarski, D.C., and Crews, C.M. (2008) A role for planar cell polarity signaling in angiogenesis. Angiogenesis. 11(4):347-360
1 - 4 of 4
Show