Morpholino
MO1-nkx2.7
- ID
- ZDB-MRPHLNO-090826-13
- Name
- MO1-nkx2.7
- Previous Names
-
- anti-nkx2.7 ATG MO (1)
- Target
- Sequence
-
5' - TGGAGGTCACAGGACTCGGAAGCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nkx2.7
No data available
Phenotype
Phenotype resulting from MO1-nkx2.7
1 - 5 of 13 Show all
Phenotype of all Fish created by or utilizing MO1-nkx2.7
1 - 5 of 48 Show all
Citations
- Bornhorst, D., Xia, P., Nakajima, H., Dingare, C., Herzog, W., Lecaudey, V., Mochizuki, N., Heisenberg, C.P., Yelon, D., Abdelilah-Seyfried, S. (2019) Biomechanical signaling within the developing zebrafish heart attunes endocardial growth to myocardial chamber dimensions. Nature communications. 10:4113
- Targoff, K.L., Colombo, S., George, V., Schell, T., Kim, S.H., Solnica-Krezel, L., and Yelon, D. (2013) Nkx genes are essential for maintenance of ventricular identity. Development (Cambridge, England). 140(20):4203-4213
- Witzel, H.R., Jungblut, B., Choe, C.P., Crump, J.G., Braun, T., and Dobreva, G. (2012) The LIM Protein Ajuba Restricts the Second Heart Field Progenitor Pool by Regulating Isl1 Activity. Developmental Cell. 23(1):58-70
- Targoff, K.L., Schell, T., and Yelon, D. (2008) Nkx genes regulate heart tube extension and exert differential effects on ventricular and atrial cell number. Developmental Biology. 322(2):314-321
1 - 4 of 4
Show