Morpholino
MO1-sars1
- ID
- ZDB-MRPHLNO-090709-1
- Name
- MO1-sars1
- Previous Names
-
- MO1-sars
- Target
- Sequence
-
5' - AGGAGAATGTGAACAAACCTGACAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sars1
No data available
Phenotype
Phenotype resulting from MO1-sars1
1 - 5 of 12 Show all
Phenotype of all Fish created by or utilizing MO1-sars1
1 - 5 of 14 Show all
Citations
- Shi, Y., Liu, Z., Zhang, Q., Vallee, I., Mo, Z., Kishi, S., Yang, X.L. (2020) Phosphorylation of seryl-tRNA synthetase by ATM/ATR is essential for hypoxia-induced angiogenesis. PLoS Biology. 18:e3000991
- Wang, K., Zhao, S., Liu, B., Zhang, Q., Li, Y., Liu, J., Shen, Y., Ding, X., Lin, J., Wu, Y., Yan, Z., Chen, J., Li, X., Song, X., Niu, Y., Liu, J., Chen, W., Ming, Y., Du, R., Chen, C., Long, B., Zhang, Y., Tong, X., Zhang, S., Posey, J.E., Zhang, B., Wu, Z., Wythe, J.D., Liu, P., Lupski, J.R., Yang, X., Wu, N. (2018) Perturbations of BMP/TGF-β and VEGF/VEGFR signalling pathways in non-syndromic sporadic brain arteriovenous malformations (BAVM). Journal of Medical Genetics. 55(10):675-684
- Shi, Y., Xu, X., Zhang, Q., Fu, G., Mo, Z., Wang, G.S., Kishi, S., Yang, X.L. (2014) tRNA synthetase counteracts c-Myc to develop functional vasculature. eLIFE. 3:e02349
- Xu, X., Yi Shi, Y., Zhang, H.-M., Swindell, E.C., Marshall, A.G., Guo, M., Kishi, S., Yang, X.-L. (2012) Unique domain appended to vertebrate tRNA synthetase is essential for vascular development. Nature communications. 3:681
- Fukui, H., Hanaoka, R., and Kawahara, A. (2009) Noncanonical Activity of Seryl-tRNA Synthetase Is Involved in Vascular Development. Circulation research. 104(11):1253-1259
1 - 5 of 5
Show