Morpholino
MO1-rab11a
- ID
- ZDB-MRPHLNO-090617-5
- Name
- MO1-rab11a
- Previous Names
-
- SZ162 (1)
- Target
- Sequence
-
5' - GTATTCGTCGTCTCGTGTCCCCATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rab11a
No data available
Phenotype
Phenotype resulting from MO1-rab11a
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO1-rab11a
1 - 5 of 12 Show all
Citations
- Aljiboury, A.A., Ingram, E., Krishnan, N., Ononiwu, F., Pal, D., Manikas, J., Taveras, C., Hall, N.A., Da Silva, J., Freshour, J., Hehnly, H. (2023) Rab8, Rab11, and Rab35 coordinate lumen and cilia formation during zebrafish left-right organizer development. PLoS Genetics. 19:e1010765e1010765
- Jopling, H.M., Odell, A.F., Pellet-Many, C., Latham, A.M., Frankel, P., Sivaprasadarao, A., Walker, J.H., Zachary, I.C., Ponnambalam, S. (2014) Endosome-to-Plasma Membrane Recycling of VEGFR2 Receptor Tyrosine Kinase Regulates Endothelial Function and Blood Vessel Formation. Cells. 3:363-85
- Tay, H.G., Schulze, S.K., Compagnon, J., Foley, F.C., Heisenberg, C.P., Yost, H.J., Abdelilah-Seyfried, S., and Amack, J.D. (2013) Lethal giant larvae 2 regulates development of the ciliated organ Kupffer's vesicle. Development (Cambridge, England). 140(7):1550-1559
- Westlake, C.J., Baye, L.M., Nachury, M.V., Wright, K.J., Ervin, K.E., Phu, L., Chalouni, C., Beck, J.S., Kirkpatrick, D.S., Slusarski, D.C., Sheffield, V.C., Scheller, R.H., and Jackson, P.K. (2011) Primary cilia membrane assembly is initiated by Rab11 and transport protein particle II (TRAPPII) complex-dependent trafficking of Rabin8 to the centrosome. Proceedings of the National Academy of Sciences of the United States of America. 108(7):2759-2764
- Kalén, M., Wallgard, E., Asker, N., Nasevicius, A., Athley, E., Billgren, E., Larson, J.D., Wadman, S.A., Norseng, E., Clark, K.J., He, L., Karlsson-Lindahl, L., Häger, A.K., Weber, H., Augustin, H., Samuelsson, T., Kemmet, C.K., Utesch, C.M., Essner, J.J., Hackett, P.B., and Hellström, M. (2009) Combination of reverse and chemical genetic screens reveals angiogenesis inhibitors and targets. Chemistry & Biology. 16(4):432-441
1 - 5 of 5
Show