Morpholino
MO2-bmpr1ab
- ID
- ZDB-MRPHLNO-090609-4
- Name
- MO2-bmpr1ab
- Previous Names
-
- alk3b MO1 (1)
- Target
- Sequence
-
5' - GTCGAGTTGTTGAACTGTATGGCTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-bmpr1ab
No data available
Phenotype
Phenotype resulting from MO2-bmpr1ab
No data available
Phenotype of all Fish created by or utilizing MO2-bmpr1ab
1 - 5 of 10 Show all
Citations
- Demal, T.J., Heise, M., Reiz, B., Dogra, D., Brænne, I., Reichenspurner, H., Männer, J., Aherrahrou, Z., Schunkert, H., Erdmann, J., Abdelilah-Seyfried, S. (2019) A familial congenital heart disease with a possible multigenic origin involving a mutation in BMPR1A. Scientific Reports. 9:2959
- Neal, A., Nornes, S., Payne, S., Wallace, M.D., Fritzsche, M., Louphrasitthiphol, P., Wilkinson, R.N., Chouliaras, K.M., Liu, K., Plant, K., Sholapurkar, R., Ratnayaka, I., Herzog, W., Bond, G., Chico, T., Bou-Gharios, G., De Val, S. (2019) Venous identity requires BMP signalling through ALK3. Nature communications. 10:453
- Kim, J.D., Kim, J. (2014) Alk3/Alk3b and Smad5 Mediate BMP Signaling during Lymphatic Development in Zebrafish. Molecules and cells. 37:270-4
- Neumann, J.C., Chandler, G.L., Damoulis, V.A., Fustino, N.J., Lillard, K., Looijenga, L., Margraf, L., Rakheja, D., and Amatruda, J.F. (2011) Mutation in the type IB bone morphogenetic protein receptor alk6b impairs germ-cell differentiation and causes germ-cell tumors in zebrafish. Proceedings of the National Academy of Sciences of the United States of America. 108(32):13153-8
- Little, S.C., and Mullins, M.C. (2009) Bone morphogenetic protein heterodimers assemble heteromeric type I receptor complexes to pattern the dorsoventral axis. Nature cell biology. 11(5):637-643
1 - 5 of 5
Show