Morpholino
MO1-bmpr1ab
- ID
- ZDB-MRPHLNO-090609-2
- Name
- MO1-bmpr1ab
- Previous Names
-
- alk3b MO3 (1)
- Target
- Sequence
-
5' - TGAAGATGAATGGACACGGTAAGAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bmpr1ab
No data available
Phenotype
Phenotype resulting from MO1-bmpr1ab
No data available
Phenotype of all Fish created by or utilizing MO1-bmpr1ab
1 - 5 of 6 Show all
Citations
- Tajer, B., Dutko, J.A., Little, S.C., Mullins, M.C. (2021) BMP heterodimers signal via distinct type I receptor class functions. Proceedings of the National Academy of Sciences of the United States of America. 118(15):
- Demal, T.J., Heise, M., Reiz, B., Dogra, D., Brænne, I., Reichenspurner, H., Männer, J., Aherrahrou, Z., Schunkert, H., Erdmann, J., Abdelilah-Seyfried, S. (2019) A familial congenital heart disease with a possible multigenic origin involving a mutation in BMPR1A. Scientific Reports. 9:2959
- Neumann, J.C., Chandler, G.L., Damoulis, V.A., Fustino, N.J., Lillard, K., Looijenga, L., Margraf, L., Rakheja, D., and Amatruda, J.F. (2011) Mutation in the type IB bone morphogenetic protein receptor alk6b impairs germ-cell differentiation and causes germ-cell tumors in zebrafish. Proceedings of the National Academy of Sciences of the United States of America. 108(32):13153-8
- Little, S.C., and Mullins, M.C. (2009) Bone morphogenetic protein heterodimers assemble heteromeric type I receptor complexes to pattern the dorsoventral axis. Nature cell biology. 11(5):637-643
1 - 4 of 4
Show