Morpholino
MO1-slc12a10.2
- ID
- ZDB-MRPHLNO-090609-1
- Name
- MO1-slc12a10.2
- Previous Names
- None
- Target
-
- slc12a10.2 (1)
- Sequence
-
5' - TTGCCAAAATCAGCCTCTCCCATAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-slc12a10.2
No data available
Phenotype
Phenotype resulting from MO1-slc12a10.2
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-slc12a10.2
1 - 5 of 6 Show all
Citations
- Kwong, R.W., Perry, S.F. (2016) A role for sodium-chloride cotransporters in the rapid regulation of ion uptake following acute environmental acidosis: New insights from the zebrafish model. American journal of physiology. Cell physiology. 311(6):C931-C941
- Lin, C.H., Hu, H.J., Hwang, P.P. (2016) Cortisol regulates sodium homeostasis by stimulating the transcription of sodium-chloride transporter (NCC) in zebrafish (Danio rerio). Molecular and Cellular Endocrinology. 422:93-102
- Wang, Y.F., Yan, J.J., Tseng, Y.C., Chen, R.D., Hwang, P.P. (2015) Molecular Physiology of an Extra-renal Cl(-) Uptake Mechanism for Body Fluid Cl(-) Homeostasis. International journal of biological sciences. 11:1190-203
- Chang, W.J., Wang, Y.F., Hu, H.J., Wang, J.H., Lee, T.H., and Hwang, P.P. (2013) Compensatory regulation of Na+ absorption by Na+/H+ exchanger and Na+-Cl- cotransporter in zebrafish (Danio rerio). Frontiers in Zoology. 10(1):46
- Wang, Y.F., Tseng, Y.C., Yan, J.J., Hiroi, J., and Hwang, P.P. (2009) Role of SLC12A10.2, a Na-Cl cotransporter-like protein, in a Cl uptake mechanism in zebrafish (Danio rerio). American journal of physiology. Regulatory, integrative and comparative physiology. 296(5):R1650-R1660
1 - 5 of 5
Show