Morpholino
MO2-nr4a2a,nr4a2b
- ID
- ZDB-MRPHLNO-090209-1
- Name
- MO2-nr4a2a,nr4a2b
- Previous Names
-
- MO2-nr4a2a+nr4a2b
- nr4a2mo (1)
- Targets
- Sequence
-
5' - CATACTGAGCCTGGACGCAGGGCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-nr4a2a,nr4a2b
No data available
Phenotype
Phenotype resulting from MO2-nr4a2a,nr4a2b
No data available
Phenotype of all Fish created by or utilizing MO2-nr4a2a,nr4a2b
1 - 5 of 12 Show all
Citations
- Prince, L.R., Dannewitz Prosseda, S., Higgins, K., Carlring, J., Prestwich, E.C., Ogryzko, N.V., Rahman, A., Basran, A., Falciani, F., Taylor, P., Renshaw, S.A., Whyte, M.K.B., Sabroe, I. (2017) NR4A orphan nuclear receptor family members, NR4A2 and NR4A3, regulate neutrophil number and survival. Blood. 130(8):1014-1025
- Chen, Y.C., Sundvik, M., Rozov, S., Priyadarshini, M., and Panula, P. (2012) MANF regulates dopaminergic neuron development in larval zebrafish. Developmental Biology. 370(2):237-249
- Blin, M., Norton, W., Bally-Cuif, L., and Vernier, P. (2008) NR4A2 controls the differentiation of selective dopaminergic nuclei in the zebrafish brain. Molecular and cellular neurosciences. 39(4):592-604
- Luo, G.R., Chen, Y., Li, X.P., Liu, T.X., and Le, W.D. (2008) Nr4a2 is essential for the differentiation of dopaminergic neurons during zebrafish embryogenesis. Molecular and cellular neurosciences. 39(2):202-210
1 - 4 of 4
Show