Morpholino
MO2-osr1
- ID
- ZDB-MRPHLNO-090121-1
- Name
- MO2-osr1
- Previous Names
-
- osr1 ex2d (1)
- Target
- Sequence
-
5' - ATCTCATCCTTACCTGTGGTCTCTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets the splice donor site of exon 2.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-osr1
No data available
Phenotype
Phenotype resulting from MO2-osr1
1 - 5 of 36 Show all
Phenotype of all Fish created by or utilizing MO2-osr1
1 - 5 of 52 Show all
Citations
- Drummond, B.E., Chambers, B.E., Wesselman, H.M., Gibson, S., Arceri, L., Ulrich, M.N., Gerlach, G.F., Kroeger, P.T., Leshchiner, I., Goessling, W., Wingert, R.A. (2022) osr1 Maintains Renal Progenitors and Regulates Podocyte Development by Promoting wnt2ba via the Antagonism of hand2. Biomedicines. 10(11):
- Chou, C.W., Hsu, H.C., You, M.S., Lin, J., Liu, Y.W. (2016) The endoderm indirectly influences morphogenetic movements of the zebrafish head kidney through the posterior cardinal vein and VegfC. Scientific Reports. 6:30677
- Terashima, A.V., Mudumana, S.P., Drummond, I.A. (2014) Odd skipped related 1 is a negative feedback regulator of Nodal-induced endoderm development. Developmental Dynamics : an official publication of the American Association of Anatomists. 243(12):1571-80
- Tomar, R., Mudumana, S.P., Pathak, N., Hukreide, N.A., Drummond, I.A. (2014) osr1 Is Required for Podocyte Development Downstream of wt1a. Journal of the American Society of Nephrology : JASN. 25(11):2539-45
- Neto, A., Mercader, N., and Gómez-Skarmeta, J.L. (2012) The osr1 and osr2 genes act in the pronephric anlage downstream of retinoic acid signaling and upstream of wnt2b to maintain pectoral fin development. Development (Cambridge, England). 139(2):301-11
- Mudumana, S.P., Hentschel, D., Liu, Y., Vasilyev, A., and Drummond, I.A. (2008) odd skipped related1 reveals a novel role for endoderm in regulating kidney versus vascular cell fate. Development (Cambridge, England). 135(20):3355-3367
1 - 6 of 6
Show