Morpholino
MO1-ryr3
- ID
- ZDB-MRPHLNO-090109-2
- Name
- MO1-ryr3
- Previous Names
- None
- Target
- Sequence
-
5' - GAGCGGCGTTTTTACTTACAGTCCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a splice blocking morpholino that targets the exon 1 splice donor site.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ryr3
No data available
Phenotype
Phenotype resulting from MO1-ryr3
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-ryr3
1 - 5 of 10 Show all
Citations
- Klatt Shaw, D., Gunther, D., Jurynec, M.J., Chagovetz, A.A., Ritchie, E., Grunwald, D.J. (2018) Intracellular Calcium Mobilization Is Required for Sonic Hedgehog Signaling. Developmental Cell. 45(4):512-525.e5
- Perni, S., Marsden, K.C., Escobar, M., Hollingworth, S., Baylor, S.M., Franzini-Armstrong, C. (2015) Structural and functional properties of ryanodine receptor type 3 in zebrafish tail muscle. The Journal of general physiology. 145(3):173-84
- Francescatto, L., Rothschild, S.C., Myers, A.L., and Tombes, R.M. (2010) The activation of membrane targeted CaMK-II in the zebrafish Kupffer's vesicle is required for left-right asymmetry. Development (Cambridge, England). 137(16):2753-2762
- Jurynec, M.J., Xia, R., Mackrill, J.J., Gunther, D., Crawford, T., Flanigan, K.M., Abramson, J.J., Howard, M.T., and Grunwald, D.J. (2008) Selenoprotein N is required for ryanodine receptor calcium release channel activity in human and zebrafish muscle. Proceedings of the National Academy of Sciences of the United States of America. 105(34):12485-12490
1 - 4 of 4
Show