Morpholino
MO1-nrg1
- ID
- ZDB-MRPHLNO-081222-2
- Name
- MO1-nrg1
- Previous Names
-
- nrg1e3i4 (1)
- Target
- Sequence
-
5' - TGCTGGTGGCTGCTGCACAGAGGAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nrg1
No data available
Phenotype
Phenotype resulting from MO1-nrg1
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-nrg1
1 - 5 of 6 Show all
Citations
- Sato, T., Sato, F., Kamezaki, A., Sakaguchi, K., Tanigome, R., Kawakami, K., Sehara-Fujisawa, A. (2015) Neuregulin 1 Type II-ErbB Signaling Promotes Cell Divisions Generating Neurons from Neural Progenitor Cells in the Developing Zebrafish Brain. PLoS One. 10:e0127360
- Rojas-Muñoz, A., Rajadhyksha, S., Gilmour, D., van Bebber, F., Antos, C., Rodríguez Esteban, C., Nüsslein-Volhard, C., and Izpisúa Belmonte, J.C. (2009) ErbB2 and ErbB3 regulate amputation-induced proliferation and migration during vertebrate regeneration. Developmental Biology. 327(1):177-190
- Wood, J.D., Bonath, F., Kumar, S., Ross, C.A., and Cunliffe, V.T. (2009) Disrupted-in-schizophrenia 1 and neuregulin 1 are required for the specification of oligodendrocytes and neurones in the zebrafish brain. Human molecular genetics. 18(3):391-404
- Milan, D.J., Giokas, A.C., Serluca, F.C., Peterson, R.T., and MacRae, C.A. (2006) Notch1b and neuregulin are required for specification of central cardiac conduction tissue. Development (Cambridge, England). 133(6):1125-1132
1 - 4 of 4
Show