Morpholino
MO1-mir9
- ID
- ZDB-MRPHLNO-081013-4
- Name
- MO1-mir9
- Previous Names
- Targets
- Sequence
-
5' - TCATACAGCTAGATAACCAAAGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mir9
No data available
Phenotype
Phenotype resulting from MO1-mir9
No data available
Phenotype of all Fish created by or utilizing MO1-mir9
1 - 5 of 40 Show all
Citations
- Madelaine, R., Notwell, J.H., Skariah, G., Halluin, C., Chen, C.C., Bejerano, G., Mourrain, P. (2018) A screen for deeply conserved non-coding GWAS SNPs uncovers a MIR-9-2 functional mutation associated to retinal vasculature defects in human. Nucleic acids research. 46(7):3517-3531
- Madelaine, R., Sloan, S.A., Huber, N., Notwell, J.H., Leung, L.C., Skariah, G., Halluin, C., Paşca, S.P., Bejerano, G., Krasnow, M.A., Barres, B.A., Mourrain, P. (2017) MicroRNA-9 Couples Brain Neurogenesis and Angiogenesis. Cell Reports. 20:1533-1542
- Katz, S., Cussigh, D., Urbán, N., Blomfield, I., Guillemot, F., Bally-Cuif, L., Coolen, M. (2016) A Nuclear Role for miR-9 and Argonaute Proteins in Balancing Quiescent and Activated Neural Stem Cell States. Cell Reports. 17:1383-1398
- Garaffo, G., Conte, D., Provero, P., Tomaiuolo, D., Luo, Z., Pinciroli, P., Peano, C., D'Atri, I., Gitton, Y., Etzion, T., Gothilf, Y., Gays, D., Santoro, M.M., Merlo, G.R. (2015) The Dlx5 and Foxg1 transcription factors, linked via miRNA-9 and -200, are required for the development of the olfactory and GnRH system. Molecular and cellular neurosciences. 68:103-19
- Coolen, M., Thieffry, D., Drivenes, O., Becker, T.S., and Bally-Cuif, L. (2012) miR-9 Controls the Timing of Neurogenesis through the Direct Inhibition of Antagonistic Factors. Developmental Cell. 22(5):1052-1064
- Leucht, C., Stigloher, C., Wizenmann, A., Klafke, R., Folchert, A., and Bally-Cuif, L. (2008) MicroRNA-9 directs late organizer activity of the midbrain-hindbrain boundary. Nature Neuroscience. 11(6):641-648
1 - 6 of 6
Show