Morpholino
MO1-ift20
- ID
- ZDB-MRPHLNO-080724-3
- Name
- MO1-ift20
- Previous Names
-
- ift20-SP (1)
- Target
- Sequence
-
5' - CAACAACGTACCTTCATTTTTTCAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ift20
No data available
Phenotype
Phenotype resulting from MO1-ift20
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-ift20
1 - 5 of 12 Show all
Citations
- Jin, M., Wang, D., Xu, W., Wang, H., Cao, Y. (2019) Claudin-7b and Claudin-h are required for controlling cilia morphogenesis in the zebrafish kidney. Mechanisms of Development. 161:103595
- He, L., Xu, W., Jing, Y., Wu, M., Song, S., Cao, Y., Mei, C. (2015) Yes-Associated Protein (Yap) Is Necessary for Ciliogenesis and Morphogenesis during Pronephros Development in Zebrafish (Danio Rerio). International journal of biological sciences. 11:935-47
- Omori, Y., Zhao, C., Saras, A., Mukhopadhyay, S., Kim, W., Furukawa, T., Sengupta, P., Veraksa, A., and Malicki, J. (2008) elipsa is an early determinant of ciliogenesis that links the IFT particle to membrane-associated small GTPase Rab8. Nature cell biology. 10(4):437-444
1 - 3 of 3
Show