Morpholino
MO2-kdr
- ID
- ZDB-MRPHLNO-080516-10
- Name
- MO2-kdr
- Previous Names
-
- kdrb-m (1)
- MO2-kdrb
- Target
- Sequence
-
5' - TATGCTCTATTAGATGCCTGTTTAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-kdr
No data available
Phenotype
Phenotype resulting from MO2-kdr
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO2-kdr
1 - 5 of 12 Show all
Citations
- Toselli, C.M., Wilkinson, B.M., Paterson, J., Kieffer, T.J. (2019) Vegfa/vegfr2 signaling is necessary for zebrafish islet vessel development, but is dispensable for beta-cell and alpha-cell formation. Scientific Reports. 9:3594
- Bridge, G., Monteiro, R., Henderson, S., Emuss, V., Lagos, D., Georgopoulou, D., Patient, R., and Boshoff, C. (2012) The microRNA-30 family targets DLL4 to modulate endothelial cell behavior during angiogenesis. Blood. 120(25):5063-5072
- Bahary, N., Goishi, K., Stuckenholz, C., Weber, G., Leblanc, J., Schafer, C.A., Berman, S.S., Klagsbrun, M., and Zon, L.I. (2007) Duplicate VegfA genes and orthologues of the KDR receptor tyrosine kinase family mediate vascular development in the zebrafish. Blood. 110(10):3627-3636
1 - 3 of 3
Show