Morpholino
MO1-tfap2c
- ID
- ZDB-MRPHLNO-080213-3
- Name
- MO1-tfap2c
- Previous Names
- None
- Target
- Sequence
-
5' - TTGGGCAGAGACACCGGACCTGGAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a splice blocking morpholino designed against the intron 4- exon 5 boundary.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tfap2c
No data available
Phenotype
Phenotype resulting from MO1-tfap2c
No data available
Phenotype of all Fish created by or utilizing MO1-tfap2c
1 - 3 of 3
Citations
- Knight, R.D., Mebus, K., d'Angelo, A., Yokoya, K., Heanue, T., and Roehl, H. (2011) Ret signalling integrates a craniofacial muscle module during development. Development (Cambridge, England). 138(10):2015-2024
- Zhou, Y., Cashman, T.J., Nevis, K.R., Obregon, P., Carney, S.A., Liu, Y., Gu, A., Mosimann, C., Sondalle, S., Peterson, R.E., Heideman, W., Burns, C.E., and Burns, C.G. (2011) Latent TGF-β binding protein 3 identifies a second heart field in zebrafish. Nature. 474(7353):645-8
- Hoffman, T.L., Javier, A.L., Campeau, S.A., Knight, R.D., and Schilling, T.F. (2007) Tfap2 transcription factors in zebrafish neural crest development and ectodermal evolution. Journal of experimental zoology. Part B, Molecular and developmental evolution. 308(5):679-691
1 - 3 of 3
Show