Morpholino

MO1-htt

ID
ZDB-MRPHLNO-070917-1
Name
MO1-htt
Previous Names
  • MO1-hd (1)
Target
Sequence
5' - GCCATTTTAACAGAAGCTGTGATGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-htt
No data available
Phenotype
Phenotype resulting from MO1-htt
Phenotype Fish Figures
apoptotic process decreased occurrence, abnormal WT + MO1-htt Fig. 1 from Henshall et al., 2009
apoptotic process increased occurrence, abnormal AB + MO1-htt Fig. 2 from Diekmann et al., 2009
blood low saturation, abnormal WT + MO1-htt Fig. 2Fig. 3 from Lumsden et al., 2007
brain apoptotic, abnormal AB + MO1-htt Fig. 2 from Diekmann et al., 2009
brain necrotic, abnormal WT + MO1-htt Fig. 2text only from Lumsden et al., 2007
cartilage development disrupted, abnormal AB + MO1-htt Fig. 5 from Futter et al., 2009
ceratobranchial cartilage aplastic, abnormal WT + MO1-htt Fig. 4 from Henshall et al., 2009
ceratobranchial cartilage morphology, abnormal WT + MO1-htt Fig. 4 from Henshall et al., 2009
ceratohyal cartilage curved caudal, abnormal WT + MO1-htt Fig. 4 from Henshall et al., 2009
cranial cartilage morphology, abnormal WT + MO1-htt Fig. 4 from Henshall et al., 2009
cranial nerve II aplastic, abnormal AB + MO1-htt Fig. 2 from Diekmann et al., 2009
embryonic viscerocranium morphogenesis disrupted, abnormal AB + MO1-htt Fig. 5 from Futter et al., 2009
extension aplastic, abnormal WT + MO1-htt Fig. 2 from Lumsden et al., 2007
extension decreased size, abnormal WT + MO1-htt Fig. 2Fig. 5 from Lumsden et al., 2007
eye decreased size, abnormal AB + MO1-htt Fig. 1Fig. 5 from Diekmann et al., 2009
Fig. 2 from Lumsden et al., 2007
growth delayed, abnormal WT + MO1-htt text only from Lumsden et al., 2007
head decreased size, abnormal AB + MO1-htt Fig. 2 from Lo Sardo et al., 2012
Fig. 1 from Diekmann et al., 2009
Fig. 2 from Lumsden et al., 2007
head neuroblast dispersed, abnormal AB + MO1-htt Fig. 2 from Lo Sardo et al., 2012
heart edematous, abnormal AB + MO1-htt Fig. 5 from Diekmann et al., 2009
lateral line neuromast decreased amount, abnormal WT + MO1-htt Fig. 1 from Henshall et al., 2009
neural tube disorganized, abnormal AB + MO1-htt Fig. 5 from Lo Sardo et al., 2012
neural tube shape, abnormal AB + MO1-htt Fig. 2 from Lo Sardo et al., 2012
neural tube neuroepithelial cell disorganized, abnormal AB + MO1-htt Fig. S5 from Lo Sardo et al., 2012
neural tube formation disrupted, abnormal AB + MO1-htt Fig. 2Fig. 5 from Lo Sardo et al., 2012
olfactory placode composition, abnormal WT + MO1-htt Fig. 1 from Henshall et al., 2009
olfactory placode olfactory receptor cell absent, abnormal WT + MO1-htt Fig. 1 from Henshall et al., 2009
pericardium edematous, abnormal WT + MO1-htt Fig. 2 from Lumsden et al., 2007
pharyngeal arch 1 decreased size, abnormal AB + MO1-htt Fig. 2 from Diekmann et al., 2009
Fig. 5 from Futter et al., 2009
pharyngeal arch 1 disoriented, abnormal AB + MO1-htt Fig. 5 from Futter et al., 2009
pharyngeal arch 1 mislocalised ventrally, abnormal AB + MO1-htt Fig. 2 from Diekmann et al., 2009
pharyngeal arch 2 decreased size, abnormal AB + MO1-htt Fig. 2 from Diekmann et al., 2009
Fig. 5 from Futter et al., 2009
pharyngeal arch 2 disoriented, abnormal AB + MO1-htt Fig. 5 from Futter et al., 2009
pharyngeal arch 2 mislocalised ventrally, abnormal AB + MO1-htt Fig. 2 from Diekmann et al., 2009
pharyngeal arch 3-7 aplastic, abnormal AB + MO1-htt Fig. 5 from Futter et al., 2009
pharyngeal arch 3-7 skeleton has fewer parts of type pharyngeal arch cartilage, abnormal AB + MO1-htt Fig. 2 from Diekmann et al., 2009
pharyngeal arch cartilage aplastic, abnormal WT + MO1-htt Fig. 4 from Henshall et al., 2009
pharyngeal arch cartilage morphology, abnormal WT + MO1-htt Fig. 4 from Henshall et al., 2009
pigment accumulation delayed, abnormal WT + MO1-htt Fig. 2 from Lumsden et al., 2007
post-vent region curvature, abnormal AB + MO1-htt Fig. 2 from Lo Sardo et al., 2012
post-vent region curved dorsal, abnormal AB + MO1-htt Fig. 5 from Diekmann et al., 2009
post-vent region morphology, abnormal WT + MO1-htt Fig. 2 from Lumsden et al., 2007
regulation of brain-derived neurotrophic factor receptor signaling pathway disrupted, abnormal WT + MO1-htt text only from Henshall et al., 2009
swim bladder aplastic, abnormal AB + MO1-htt Fig. 1 from Diekmann et al., 2009
tail bud decreased size, abnormal WT + MO1-htt Fig. 3 from Henshall et al., 2009
trunk larval melanophore stripe misaligned with whole organism anterior-posterior axis, abnormal WT + MO1-htt Fig. 2 from Lumsden et al., 2007
trunk melanocyte disorganized, abnormal WT + MO1-htt Fig. 2 from Lumsden et al., 2007
ventral mandibular arch malformed, abnormal AB + MO1-htt Fig. 1 from Diekmann et al., 2009
ventricular system decreased size, abnormal WT + MO1-htt Fig. 2 from Lumsden et al., 2007
ventricular system increased size, abnormal AB + MO1-htt Fig. 1 from Diekmann et al., 2009
whole organism decreased length, abnormal WT + MO1-htt Fig. 2 from Lumsden et al., 2007
whole organism increased curvature, abnormal WT + MO1-htt Fig. 2 from Lumsden et al., 2007
Phenotype of all Fish created by or utilizing MO1-htt
Phenotype Fish Conditions Figures
pharyngeal arch 1 mislocalised ventrally, abnormal AB + MO1-htt standard conditions Fig. 2 from Diekmann et al., 2009
post-vent region curved dorsal, abnormal AB + MO1-htt standard conditions Fig. 5 from Diekmann et al., 2009
neural tube neuroepithelial cell disorganized, abnormal AB + MO1-htt standard conditions Fig. S5 from Lo Sardo et al., 2012
ventricular system increased size, abnormal AB + MO1-htt standard conditions Fig. 1 from Diekmann et al., 2009
apoptotic process increased occurrence, abnormal AB + MO1-htt standard conditions Fig. 2 from Diekmann et al., 2009
neural tube formation disrupted, abnormal AB + MO1-htt standard conditions Fig. 2Fig. 5 from Lo Sardo et al., 2012
post-vent region curvature, abnormal AB + MO1-htt standard conditions Fig. 2 from Lo Sardo et al., 2012
eye decreased size, abnormal AB + MO1-htt standard conditions Fig. 1Fig. 5 from Diekmann et al., 2009
swim bladder aplastic, abnormal AB + MO1-htt standard conditions Fig. 1 from Diekmann et al., 2009
neural tube shape, abnormal AB + MO1-htt standard conditions Fig. 2 from Lo Sardo et al., 2012
neural tube disorganized, abnormal AB + MO1-htt standard conditions Fig. 5 from Lo Sardo et al., 2012
ventral mandibular arch malformed, abnormal AB + MO1-htt standard conditions Fig. 1 from Diekmann et al., 2009
pharyngeal arch 1 decreased size, abnormal AB + MO1-htt standard conditions Fig. 2 from Diekmann et al., 2009
Fig. 5 from Futter et al., 2009
pharyngeal arch 3-7 aplastic, abnormal AB + MO1-htt standard conditions Fig. 5 from Futter et al., 2009
pharyngeal arch 2 disoriented, abnormal AB + MO1-htt standard conditions Fig. 5 from Futter et al., 2009
cartilage development disrupted, abnormal AB + MO1-htt standard conditions Fig. 5 from Futter et al., 2009
embryonic viscerocranium morphogenesis disrupted, abnormal AB + MO1-htt standard conditions Fig. 5 from Futter et al., 2009
pharyngeal arch 3-7 skeleton has fewer parts of type pharyngeal arch cartilage, abnormal AB + MO1-htt standard conditions Fig. 2 from Diekmann et al., 2009
heart edematous, abnormal AB + MO1-htt standard conditions Fig. 5 from Diekmann et al., 2009
pharyngeal arch 2 mislocalised ventrally, abnormal AB + MO1-htt standard conditions Fig. 2 from Diekmann et al., 2009
head neuroblast dispersed, abnormal AB + MO1-htt standard conditions Fig. 2 from Lo Sardo et al., 2012
pharyngeal arch 2 decreased size, abnormal AB + MO1-htt standard conditions Fig. 2 from Diekmann et al., 2009
Fig. 5 from Futter et al., 2009
brain apoptotic, abnormal AB + MO1-htt standard conditions Fig. 2 from Diekmann et al., 2009
pharyngeal arch 1 disoriented, abnormal AB + MO1-htt standard conditions Fig. 5 from Futter et al., 2009
head decreased size, abnormal AB + MO1-htt standard conditions Fig. 2 from Lo Sardo et al., 2012
Fig. 1 from Diekmann et al., 2009
cranial nerve II aplastic, abnormal AB + MO1-htt standard conditions Fig. 2 from Diekmann et al., 2009
lateral line neuromast decreased amount, abnormal WT + MO1-htt standard conditions Fig. 1 from Henshall et al., 2009
tail bud decreased size, abnormal WT + MO1-htt standard conditions Fig. 3 from Henshall et al., 2009
pigment accumulation delayed, abnormal WT + MO1-htt standard conditions Fig. 2 from Lumsden et al., 2007
ceratobranchial cartilage morphology, abnormal WT + MO1-htt standard conditions Fig. 4 from Henshall et al., 2009
cranial cartilage morphology, abnormal WT + MO1-htt standard conditions Fig. 4 from Henshall et al., 2009
olfactory placode composition, abnormal WT + MO1-htt standard conditions Fig. 1 from Henshall et al., 2009
apoptotic process decreased occurrence, abnormal WT + MO1-htt standard conditions Fig. 1 from Henshall et al., 2009
pericardium edematous, abnormal WT + MO1-htt standard conditions Fig. 2 from Lumsden et al., 2007
head decreased size, abnormal WT + MO1-htt standard conditions Fig. 2 from Lumsden et al., 2007
growth delayed, abnormal WT + MO1-htt standard conditions text only from Lumsden et al., 2007
whole organism increased curvature, abnormal WT + MO1-htt standard conditions Fig. 2 from Lumsden et al., 2007
regulation of brain-derived neurotrophic factor receptor signaling pathway disrupted, abnormal WT + MO1-htt standard conditions text only from Henshall et al., 2009
brain necrotic, abnormal WT + MO1-htt standard conditions Fig. 2text only from Lumsden et al., 2007
trunk melanocyte disorganized, abnormal WT + MO1-htt standard conditions Fig. 2 from Lumsden et al., 2007
ceratohyal cartilage curved caudal, abnormal WT + MO1-htt standard conditions Fig. 4 from Henshall et al., 2009
whole organism decreased length, abnormal WT + MO1-htt standard conditions Fig. 2 from Lumsden et al., 2007
pharyngeal arch cartilage aplastic, abnormal WT + MO1-htt standard conditions Fig. 4 from Henshall et al., 2009
trunk larval melanophore stripe misaligned with whole organism anterior-posterior axis, abnormal WT + MO1-htt standard conditions Fig. 2 from Lumsden et al., 2007
blood low saturation, abnormal WT + MO1-htt standard conditions Fig. 2Fig. 3 from Lumsden et al., 2007
pharyngeal arch cartilage morphology, abnormal WT + MO1-htt standard conditions Fig. 4 from Henshall et al., 2009
eye decreased size, abnormal WT + MO1-htt standard conditions Fig. 2 from Lumsden et al., 2007
ceratobranchial cartilage aplastic, abnormal WT + MO1-htt standard conditions Fig. 4 from Henshall et al., 2009
olfactory placode olfactory receptor cell absent, abnormal WT + MO1-htt standard conditions Fig. 1 from Henshall et al., 2009
extension aplastic, abnormal WT + MO1-htt standard conditions Fig. 2 from Lumsden et al., 2007
post-vent region morphology, abnormal WT + MO1-htt standard conditions Fig. 2 from Lumsden et al., 2007
ventricular system decreased size, abnormal WT + MO1-htt standard conditions Fig. 2 from Lumsden et al., 2007
extension decreased size, abnormal WT + MO1-htt standard conditions Fig. 2Fig. 5 from Lumsden et al., 2007
Citations