Morpholino
MO2-rad21a
- ID
- ZDB-MRPHLNO-070904-2
- Name
- MO2-rad21a
- Previous Names
-
- MO1-rad21
- rad21ATGMO (1)
- Target
- Sequence
-
5' - AGGACGAAGTGGGCGTAAAACATTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-rad21a
No data available
Phenotype
Phenotype resulting from MO2-rad21a
1 - 5 of 53 Show all
Phenotype of all Fish created by or utilizing MO2-rad21a
1 - 5 of 76 Show all
Citations
- Mazzola, M., Pezzotta, A., Fazio, G., Rigamonti, A., Bresciani, E., Gaudenzi, G., Pelleri, M.C., Saitta, C., Ferrari, L., Parma, M., Fumagalli, M., Biondi, A., Cazzaniga, G., Marozzi, A., Pistocchi, A. (2020) Dysregulation of NIPBL leads to impaired RUNX1 expression and haematopoietic defects. Journal of Cellular and Molecular Medicine. 24(11):6272-6282
- Meier, M., Grant, J., Dowdle, A., Thomas, A., Gerton, J., Collas, P., O'Sullivan, J.M., Horsfield, J.A. (2017) Cohesin facilitates zygotic genome activation in zebrafish. Development (Cambridge, England). 145(1)
- Schuster, K., Leeke, B., Meier, M., Wang, Y., Newman, T., Burgess, S., Horsfield, J.A. (2015) A neural crest origin for cohesinopathy heart defects. Human molecular genetics. 24(24):7005-16
- Xu, B., Sowa, N., Cardenas, M.E., Gerton, J.L. (2015) L-leucine partially rescues translational and developmental defects associated with zebrafish models of Cornelia de Lange syndrome. Human molecular genetics. 24(6):1540-55
- Marsman, J., O'Neill, A.C., Kao, B.R., Rhodes, J.M., Meier, M., Antony, J., Mönnich, M., and Horsfield, J.A. (2014) Cohesin and CTCF differentially regulate spatiotemporal runx1 expression during zebrafish development. Biochimica et biophysica acta. Gene regulatory mechanisms. 1839(1):50-61
- Muto, A., Ikeda, S., Lopez-Burks, M.E., Kikuchi, Y., Calof, A.L., Lander, A.D., Schilling, T.F. (2014) Nipbl and Mediator Cooperatively Regulate Gene Expression to Control Limb Development. PLoS Genetics. 10:e1004671
- Muto, A., Calof, A.L., Lander, A.D., and Schilling, T.F. (2011) Multifactorial Origins of Heart and Gut Defects in nipbl-Deficient Zebrafish, a Model of Cornelia de Lange Syndrome. PLoS Biology. 9(10):e1001181
- Horsfield, J.A., Anagnostou, S.H., Hu, J.K., Cho, K.H., Geisler, R., Lieschke, G., Crosier, K.E., and Crosier, P.S. (2007) Cohesin-dependent regulation of Runx genes. Development (Cambridge, England). 134(14):2639-2649
1 - 8 of 8
Show