Morpholino
MO1-cdh5
- ID
- ZDB-MRPHLNO-070810-2
- Name
- MO1-cdh5
- Previous Names
- None
- Target
- Sequence
-
5' - TTTACAAGACCGTCTACCTTTCCAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice site morpholino.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdh5
No data available
Phenotype
Phenotype resulting from MO1-cdh5
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-cdh5
1 - 5 of 11 Show all
Citations
- Klems, A., van Rijssel, J., Ramms, A.S., Wild, R., Hammer, J., Merkel, M., Derenbach, L., Préau, L., Hinkel, R., Suarez-Martinez, I., Schulte-Merker, S., Vidal, R., Sauer, S., Kivelä, R., Alitalo, K., Kupatt, C., van Buul, J.D., le Noble, F. (2020) The GEF Trio controls endothelial cell size and arterial remodeling downstream of Vegf signaling in both zebrafish and cell models. Nature communications. 11:5319
- Bornhorst, D., Xia, P., Nakajima, H., Dingare, C., Herzog, W., Lecaudey, V., Mochizuki, N., Heisenberg, C.P., Yelon, D., Abdelilah-Seyfried, S. (2019) Biomechanical signaling within the developing zebrafish heart attunes endocardial growth to myocardial chamber dimensions. Nature communications. 10:4113
- Ni, R., Luo, L. (2018) A noncanonical function of histidyl-tRNA synthetase: inhibition of vascular hyperbranching during zebrafish development. FEBS Open Bio. 8:722-731
- Sauteur, L., Affolter, M., Belting, H.G. (2017) Distinct and redundant functions of Esam and VE-cadherin during vascular morphogenesis. Development (Cambridge, England). 144(8):1554-1565
- Lee, H.C., Lo, H.C., Lo, D.M., Su, M.Y., Hu, J.R., Wu, C.C., Chang, S.N., Dai, M.S., Tsai, C.T., Tsai, H.J. (2015) Amiodarone Induces Overexpression of Similar to Versican b to Repress the EGFR/Gsk3b/Snail Signaling Axis during Cardiac Valve Formation of Zebrafish Embryos. PLoS One. 10:e0144751
- Chen, Y.H., Hsu, R.J., Chen, T.Y., Huang, Y.K., Lee, H.C., Hu, S.C., Harn, H.J., Jeng, J.R., Sun, C.K., Lin, S.Z., and Tsai, H.J. (2012) The toxic effect of Amiodarone on valve formation in the developing heart of zebrafish embryos. Reproductive toxicology (Elmsford, N.Y.). 33(2):233-244
- Tobia, C., Chiodelli, P., Nicoli, S., Dell'era, P., Buraschi, S., Mitola, S., Foglia, E., van Loenen, P.B., Alewijnse, A.E., and Presta, M. (2012) Sphingosine-1-Phosphate Receptor-1 Controls Venous Endothelial Barrier Integrity in Zebrafish. Arterioscler. Thromb. Vasc. Biol.. 32(9):e104-116
- Gjini, E., Hekking, L.H., Küchler, A., Saharinen, P., Wienholds, E., Post, J.A., Alitalo, K., and Schulte-Merker, S. (2011) Zebrafish Tie-2 shares a redundant role with Tie-1 in heart development and regulates vessel integrity. Disease models & mechanisms. 4(1):57-66
- Mitchell, I.C., Brown, T.S., Terada, L.S., Amatruda, J.F., and Nwariaku, F.E. (2010) Effect of Vascular Cadherin Knockdown on Zebrafish Vasculature during Development. PLoS One. 5(1):e8807
- Nicoli, S., Ribatti, D., Cotelli, F., and Presta, M. (2007) Mammalian tumor xenografts induce neovascularization in zebrafish embryos. Cancer research. 67(7):2927-2931
1 - 10 of 10
Show