Morpholino
MO3-mef2d,mef2ca
- ID
- ZDB-MRPHLNO-070730-5
- Name
- MO3-mef2d,mef2ca
- Previous Names
-
- MO2-mef2d/c
- MO3-mef2d+mef2c
- MO3-mef2d+mef2ca
- Targets
- Sequence
-
5' - GAATCTGGATCTTTTTCCTCCCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Perfect match to mef2d sequence, very close to mef2c, predicted to knock down translation of both genes.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-mef2d,mef2ca
No data available
Phenotype
Phenotype resulting from MO3-mef2d,mef2ca
No data available
Phenotype of all Fish created by or utilizing MO3-mef2d,mef2ca
1 - 5 of 14 Show all
Citations
- Vandernoot, I., Haerlingen, B., Gillotay, P., Trubiroha, A., Janssens, V., Opitz, R., Costagliola, S. (2020) Enhanced canonical Wnt signaling during early zebrafish development perturbs the interaction of cardiac mesoderm and pharyngeal endoderm and causes thyroid specification defects. Thyroid : official journal of the American Thyroid Association. 31(3):420-438
- Hinits, Y., Pan, L., Walker, C., Dowd, J., Moens, C.B., and Hughes, S.M. (2012) Zebrafish Mef2ca and Mef2cb are essential for both first and second heart field cardiomyocyte differentiation. Developmental Biology. 369(2):199-210
- Hinits, Y., and Hughes, S.M. (2007) Mef2s are required for thick filament formation in nascent muscle fibres. Development (Cambridge, England). 134(13):2511-2519
1 - 3 of 3
Show