Morpholino
MO5-notch1a
- ID
- ZDB-MRPHLNO-070622-1
- Name
- MO5-notch1a
- Previous Names
- None
- Target
- Sequence
-
5' - GTAGTGTTAAACTGTTACCTTGTGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
blocks splicing at exon1-intron1 boundary
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-notch1a
No data available
Phenotype
Phenotype resulting from MO5-notch1a
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO5-notch1a
1 - 5 of 10 Show all
Citations
- Zhao, F., He, J., Tang, J., Cui, N., Shi, Y., Li, Z., Liu, S., Wang, Y., Ma, M., Zhao, C., Luo, L., Li, L. (2022) Brain milieu induces early microglial maturation through the BAX-Notch axis. Nature communications. 13:6117
- Tie, R., Li, H., Cai, S., Liang, Z., Shan, W., Wang, B., Tan, Y., Zheng, W., Huang, H. (2019) Interleukin-6 signaling regulates hematopoietic stem cell emergence. Experimental & molecular medicine. 51:1-12
- Almeida, R.G., Pan, S., Cole, K.L.H., Williamson, J.M., Early, J.J., Czopka, T., Klingseisen, A., Chan, J.R., Lyons, D.A. (2018) Myelination of Neuronal Cell Bodies when Myelin Supply Exceeds Axonal Demand. Current biology : CB. 28(8):1296-1305.e5
- Chou, C.W., Lin, J., Jiang, Y.J., Liu, Y.W. (2017) Aberrant global and Jagged-mediated Notch signaling disrupts segregation between wt1-expressing and steroidogenic tissues in zebrafish. Endocrinology. 158(12):4206-4217
- Butko, E., Distel, M., Pouget, C., Weijts, B., Kobayashi, I., Ng, K., Mosimann, C., Poulain, F.E., McPherson, A., Ni, C.W., Stachura, D.L., Del Cid, N., Espín-Palazón, R., Lawson, N.D., Dorsky, R., Clements, W.K., Traver, D. (2015) Gata2b is a restricted early regulator of hemogenic endothelium in the zebrafish embryo. Development (Cambridge, England). 142:1050-61
- Espín-Palazón, R., Stachura, D.L., Campbell, C.A., García-Moreno, D., Del Cid, N., Kim, A.D., Candel, S., Meseguer, J., Mulero, V., Traver, D. (2014) Proinflammatory signaling regulates hematopoietic stem cell emergence. Cell. 159:1070-85
- Kim, A.D., Melick, C.H., Clements, W.K., Stachura, D.L., Distel, M., Panáková, D., MacRae, C., Mork, L.A., Crump, J.G., Traver, D. (2014) Discrete Notch signaling requirements in the specification of hematopoietic stem cells. The EMBO journal. 33(20):2363-73
- Almeida, R.G., Czopka, T., Ffrench-Constant, C., and Lyons, D.A. (2011) Individual axons regulate the myelinating potential of single oligodendrocytes in vivo. Development (Cambridge, England). 138(20):4443-50
- Ma, M., and Jiang, Y.J. (2007) Jagged2a-notch signaling mediates cell fate choice in the zebrafish pronephric duct. PLoS Genetics. 3(1):e18
1 - 9 of 9
Show