Morpholino
MO2-cdh2
- ID
- ZDB-MRPHLNO-070621-1
- Name
- MO2-cdh2
- Previous Names
-
- ncad-MO2 (1)
- Target
- Sequence
-
5' - CGGTGAAACCAGGCTGACATGGCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cdh2
No data available
Phenotype
Phenotype resulting from MO2-cdh2
No data available
Phenotype of all Fish created by or utilizing MO2-cdh2
1 - 5 of 13 Show all
Citations
- Babb-Clendenon, S., Shen, Y.C., Liu, Q., Turner, K.E., Mills, M.S., Cook, G.W.,Miller, C.A., Gattone, V.H. 2nd, Barald, K.F., and Marrs, J.A. (2006) Cadherin-2 participates in the morphogenesis of the zebrafish inner ear. Journal of Cell Science. 119(24):5169-5177
- Liu, Q., Kerstetter, A.E., Azodi, E., and Marrs, J.A. (2003) Cadherin-1, -2, and -11 expression and cadherin-2 function in the pectoral limb bud and fin of the developing zebrafish. Developmental Dynamics : an official publication of the American Association of Anatomists. 228(4):734-739
- Lele, Z., Folchert, A., Concha, M., Rauch, G.-J., Geisler, R., Rosa, F., Wilson, S.W., Hammerschmidt, M., and Bally-Cuif, L. (2002) parachute/n-cadherin is required for morphogenesis and maintained integrity of the zebrafish neural tube. Development (Cambridge, England). 129(14):3281-3294
1 - 3 of 3
Show