Morpholino
MO1-tcf7
- ID
- ZDB-MRPHLNO-070605-7
- Name
- MO1-tcf7
- Previous Names
- None
- Target
- Sequence
-
5' - AGCTGCGGCATGATCCAAACTTTCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
translation-blocker
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tcf7
No data available
Phenotype
Phenotype resulting from MO1-tcf7
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-tcf7
1 - 5 of 8 Show all
Citations
- Nicenboim, J., Malkinson, G., Lupo, T., Asaf, L., Sela, Y., Mayseless, O., Gibbs-Bar, L., Senderovich, N., Hashimshony, T., Shin, M., Jerafi-Vider, A., Avraham-Davidi, I., Krupalnik, V., Hofi, R., Almog, G., Astin, J.W., Golani, O., Ben-Dor, S., Crosier, P.S., Herzog, W., Lawson, N.D., Hanna, J.H., Yanai, I., Yaniv, K. (2015) Lymphatic vessels arise from specialized angioblasts within a venous niche. Nature. 522(7554):56-61
- Zhu, P., Xu, X., Lin, X. (2015) Both ciliary and non-ciliary functions of Foxj1a confer Wnt/β-catenin signaling in zebrafish left-right patterning. Biology Open. 4(11):1376-86
- Shimizu, N., Kawakami, K., and Ishitani, T. (2012) Visualization and exploration of Tcf/Lef function using a highly responsive Wnt/beta-catenin signaling-reporter transgenic zebrafish. Developmental Biology. 370(1):71-85
- Aman, A., Nguyen, M., and Piotrowski, T. (2011) Wnt/β-catenin dependent cell proliferation underlies segmented lateral line morphogenesis. Developmental Biology. 349(2):470-482
- McGraw, H.F., Drerup, C.M., Culbertson, M.D., Linbo, T., Raible, D.W., and Nechiporuk, A.V. (2011) Lef1 is required for progenitor cell identity in the zebrafish lateral line primordium. Development (Cambridge, England). 138(18):3921-3930
- Bonner, J., Gribble, S.L., Veien, E.S., Nikolaus, O.B., Weidinger, G., and Dorsky, R.I. (2008) Proliferation and patterning are mediated independently in the dorsal spinal cord downstream of canonical Wnt signaling. Developmental Biology. 313(1):398-407
- Nagayoshi, S., Hayashi, E., Abe, G., Osato, N., Asakawa, K., Urasaki, A., Horikawa, K., Ikeo, K., Takeda, H., and Kawakami, K. (2008) Insertional mutagenesis by the Tol2 transposon-mediated enhancer trap approach generated mutations in two developmental genes: tcf7 and synembryn-like. Development (Cambridge, England). 135(1):159-169
- Nyholm, M.K., Wu, S.F., Dorsky, R.I., and Grinblat, Y. (2007) The zebrafish zic2a-zic5 gene pair acts downstream of canonical Wnt signaling to control cell proliferation in the developing tectum. Development (Cambridge, England). 134(4):735-746
1 - 8 of 8
Show