Morpholino
MO2-pbx2
- ID
- ZDB-MRPHLNO-070529-2
- Name
- MO2-pbx2
- Previous Names
-
- Pbx2MO2 (1)
- Target
- Sequence
-
5' - GCTGCAACATCCTGAGCACTACATT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pbx2
No data available
Phenotype
Phenotype resulting from MO2-pbx2
No data available
Phenotype of all Fish created by or utilizing MO2-pbx2
1 - 5 of 33 Show all
Citations
- Selland, L.G., Koch, S., Laraque, M., Waskiewicz, A.J. (2018) Coordinate regulation of retinoic acid synthesis by pbx genes and fibroblast growth factor signaling by hoxb1b is required for hindbrain patterning and development. Mechanisms of Development. 150:28-41
- Yao, Z., Farr, G.H., Tapscott, S.J., and Maves, L. (2013) Pbx and Prdm1a transcription factors differentially regulate subsets of the fast skeletal muscle program in zebrafish. Biology Open. 2(6):546-555
- Erickson, T., Pillay, L.M., and Waskiewicz, A.J. (2011) Zebrafish Tshz3b negatively regulates Hox function in the developing hindbrain. Genesis (New York, N.Y. : 2000). 49(9):725-42
- Lukowski, C.M., Drummond, D.L., and Waskiewicz, A.J. (2011) Pbx-dependent regulation of lbx gene expression in developing zebrafish embryos. Genome. 54(12):973-85
- Pillay, L.M., Forrester, A.M., Erickson, T., Berman, J.N., and Waskiewicz, A.J. (2010) The Hox cofactors Meis1 and Pbx act upstream of gata1 to regulate primitive hematopoiesis. Developmental Biology. 340(2):306-317
- Maves, L., Tyler, A., Moens, C.B., and Tapscott, S.J. (2009) Pbx acts with Hand2 in early myocardial differentiation. Developmental Biology. 333(2):409-418
- Erickson, T., Scholpp, S., Brand, M., Moens, C.B., and Waskiewicz, A. Jan (2007) Pbx proteins cooperate with Engrailed to pattern the midbrain-hindbrain and diencephalic-mesencephalic boundaries. Developmental Biology. 301(2):504-517
- Maves, L., Waskiewicz, A.J., Paul, B., Cao, Y., Tyler, A., Moens, C.B., and Tapscott, S.J. (2007) Pbx homeodomain proteins direct Myod activity to promote fast-muscle differentiation. Development (Cambridge, England). 134(18):3371-3382
1 - 8 of 8
Show