Morpholino
MO2-dll4
- ID
- ZDB-MRPHLNO-070509-2
- Name
- MO2-dll4
- Previous Names
- None
- Target
- Sequence
-
5' - CGAATCTTACCTACAGGTAGATCCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice blocking morpholino.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-dll4
No data available
Phenotype
Phenotype resulting from MO2-dll4
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO2-dll4
1 - 5 of 22 Show all
Citations
- Sahu, A., Devi, S., Jui, J., Goldman, D. (2021) Notch signaling via Hey1 and Id2b regulates Müller glia's regenerative response to retinal injury. Glia. 69(12):2882-2898
- Taberner, L., Bañón, A., Alsina, B. (2020) Sensory Neuroblast Quiescence Depends on Vascular Cytoneme Contacts and Sensory Neuronal Differentiation Requires Initiation of Blood Flow. Cell Reports. 32:107903
- Chen, X., Gays, D., Milia, C., Santoro, M.M. (2017) Cilia Control Vascular Mural Cell Recruitment in Vertebrates. Cell Reports. 18:1033-1047
- Hasan, S.S., Tsaryk, R., Lange, M., Wisniewski, L., Moore, J.C., Lawson, N.D., Wojciechowska, K., Schnittler, H., Siekmann, A.F. (2017) Endothelial Notch signalling limits angiogenesis via control of artery formation. Nature cell biology. 19(8):928-940
- Shin, M., Beane, T., Quillien, A., Male, I., Zhu, L.J., Lawson, N.D. (2016) Vegfa signals through ERK to promote angiogenesis, but not artery differentiation. Development (Cambridge, England). 143(20):3796-3805
- Rochon, E.R., Wright, D.S., Schubert, M.M., Roman, B.L. (2015) Context-specific interactions between Notch and ALK1 cannot explain ALK1-associated arteriovenous malformations. Cardiovascular research. 107(1):143-52
- Okigawa, S., Mizoguchi, T., Okano, M., Tanaka, H., Isoda, M., Jiang, Y.J., Suster, M., Higashijima, S.I., Kawakami, K., Itoh, M. (2014) Different combinations of Notch ligands and receptors regulate V2 interneuron progenitor proliferation and V2a/V2b cell fate determination. Developmental Biology. 391(2):196-206
- Quillien, A., Moore, J.C., Shin, M., Siekmann, A.F., Smith, T., Pan, L., Moens, C.B., Parsons, M.J., Lawson, N.D. (2014) Distinct Notch signaling outputs pattern the developing arterial system. Development (Cambridge, England). 141:1544-52
- Villefranc, J.A., Nicoli, S., Bentley, K., Jeltsch, M., Zarkada, G., Moore, J.C., Gerhardt, H., Alitalo, K., and Lawson, N.D. (2013) A truncation allele in vascular endothelial growth factor c reveals distinct modes of signaling during lymphatic and vascular development. Development (Cambridge, England). 140(7):1497-1506
- Nicoli, S., Knyphausen, C.P., Zhu, L.J., Lakshmanan, A., and Lawson, N.D. (2012) miR-221 Is Required for Endothelial Tip Cell Behaviors during Vascular Development. Developmental Cell. 22(2):418-429
1 - 10 of 12
Show