Morpholino
MO1-dll4
- ID
- ZDB-MRPHLNO-070509-1
- Name
- MO1-dll4
- Previous Names
- None
- Target
- Sequence
-
5' - GTTCGAGCTTACCGGCCACCCAAAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice blocking morpholino.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dll4
No data available
Phenotype
Phenotype resulting from MO1-dll4
1 - 5 of 12 Show all
Phenotype of all Fish created by or utilizing MO1-dll4
1 - 5 of 17 Show all
Citations
- Bonkhofer, F., Rispoli, R., Pinheiro, P., Krecsmarik, M., Schneider-Swales, J., Tsang, I.H.C., de Bruijn, M., Monteiro, R., Peterkin, T., Patient, R. (2019) Blood stem cell-forming haemogenic endothelium in zebrafish derives from arterial endothelium. Nature communications. 10:3577
- Page, D.J., Thuret, R., Venkatraman, L., Takahashi, T., Bentley, K., Herbert, S.P. (2019) Positive Feedback Defines the Timing, Magnitude, and Robustness of Angiogenesis. Cell Reports. 27:3139-3151.e5
- Shi, Y., Duan, X., Xu, G., Wang, X., Wei, G., Dong, S., Xie, G., Liu, D. (2019) A ribosomal DNA-hosted microRNA regulates zebrafish embryonic angiogenesis. Angiogenesis. 22(2):211-221
- Chen, D., Tang, J., Wan, Q., Zhang, J., Wang, K., Shen, Y., Yu, Y. (2017) E-Prostanoid 3 Receptor Mediates Sprouting Angiogenesis Through Suppression of the Protein Kinase A/β-Catenin/Notch Pathway. Arteriosclerosis, Thrombosis, and Vascular Biology. 37(5):856-866
- Costa, G., Harrington, K.I., Lovegrove, H.E., Page, D.J., Chakravartula, S., Bentley, K., Herbert, S.P. (2016) Asymmetric division coordinates collective cell migration in angiogenesis. Nature cell biology. 18(12):1292-1301
- Zhou, Y., Ge, R., Wang, R., Liu, F., Huang, Y., Liu, H., Hao, Y., Zhou, Q., Wang, C. (2015) UXT potentiates angiogenesis by attenuating Notch signaling. Development (Cambridge, England). 142(4):774-86
- Jiang, Q., Lagos-Quintana, M., Liu, D., Shi, Y., Helker, C., Herzog, W., and le Noble, F. (2013) miR-30a Regulates Endothelial Tip Cell Formation and Arteriolar Branching. Hypertension (Dallas, Tex. : 1979). 62(3):592-8
- Sacilotto, N., Monteiro, R., Fritzsche, M., Becker, P.W., Sanchez-Del-Campo, L., Liu, K., Pinheiro, P., Ratnayaka, I., Davies, B., Goding, C.R., Patient, R., Bou-Gharios, G., and De Val, S. (2013) Analysis of Dll4 regulation reveals a combinatorial role for Sox and Notch in arterial development. Proceedings of the National Academy of Sciences of the United States of America. 110(29):11893-8
- Bridge, G., Monteiro, R., Henderson, S., Emuss, V., Lagos, D., Georgopoulou, D., Patient, R., and Boshoff, C. (2012) The microRNA-30 family targets DLL4 to modulate endothelial cell behavior during angiogenesis. Blood. 120(25):5063-5072
- Guarani, V., Deflorian, G., Franco, C.A., Krüger, M., Phng, L.K., Bentley, K., Toussaint, L., Dequiedt, F., Mostoslavsky, R., Schmidt, M.H., Zimmermann, B., Brandes, R.P., Mione, M., Westphal, C.H., Braun, T., Zeiher, A.M., Gerhardt, H., Dimmeler, S., and Potente, M. (2011) Acetylation-dependent regulation of endothelial Notch signalling by the SIRT1 deacetylase. Nature. 473(7346):234-238
1 - 10 of 11
Show