Morpholino
MO4-dlx4b
- ID
- ZDB-MRPHLNO-070504-2
- Name
- MO4-dlx4b
- Previous Names
-
- dlx7-1 MO (1)
- Target
- Sequence
-
5' - TAACCGTCAAGTCCATAAAGCCCGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-dlx4b
No data available
Phenotype
Phenotype resulting from MO4-dlx4b
No data available
Phenotype of all Fish created by or utilizing MO4-dlx4b
from 1 - 5 of 11 Show all
Citations
- Staudt, N., Giger, F.A., Fielding, T., Hutt, J.A., Foucher, I., Snowden, V., Hellich, A., Kiecker, C., Houart, C. (2019) Pineal progenitors originate from a non-neural territory limited by FGF signalling. Development (Cambridge, England). 146(22):
- Bhat, N., and Riley, B.B. (2011) Integrin-α5 Coordinates Assembly of Posterior Cranial Placodes in Zebrafish and Enhances Fgf-Dependent Regulation of Otic/Epibranchial Cells. PLoS One. 6(12):e27778
- Millimaki, B.B., Sweet, E.M., Dhason, M.S., and Riley, B.B. (2007) Zebrafish atoh1 genes: classic proneural activity in the inner ear and regulation by Fgf and Notch. Development (Cambridge, England). 134(2):295-305
- Sun, S.K., Dee, C.T., Tripathi, V.B., Rengifo, A., Hirst, C.S., and Scotting, P.J. (2007) Epibranchial and otic placodes are induced by a common Fgf signal, but their subsequent development is independent. Developmental Biology. 303(2):675-686
- Kaji, T., and Artinger, K.B. (2004) dlx3b and dlx4b function in the development of Rohon-Beard sensory neurons and trigeminal placode in the zebrafish neurula. Developmental Biology. 276(2):523-540
- Solomon, K.S. and Fritz, A. (2002) Concerted action of two dlx paralogs in sensory placode formation. Development (Cambridge, England). 129(13):3127-3136
1 - 6 of 6
Show