Morpholino
MO5-runx2b
- ID
- ZDB-MRPHLNO-061127-8
- Name
- MO5-runx2b
- Previous Names
-
- runx2bT2MO (1)
- Target
- Sequence
-
5' - AAGCAGGACACTTACCCCAGAAGAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-runx2b
No data available
Phenotype
Phenotype resulting from MO5-runx2b
Phenotype | Fish | Figures |
---|---|---|
chondrocyte differentiation delayed, abnormal | WT + MO5-runx2b |
Fig. 4 ![]() |
cranium decreased size, abnormal | WT + MO5-runx2b |
Fig. 4 ![]() |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO5-runx2b
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
cranium decreased size, abnormal | WT + MO5-runx2b | standard conditions |
Fig. 4 ![]() |
chondrocyte differentiation delayed, abnormal | WT + MO5-runx2b | standard conditions |
Fig. 4 ![]() |
1 - 2 of 2
Citations
- Flores, M.V., Lam, E.Y., Crosier, K.E., and Crosier, P.S. (2008) Osteogenic transcription factor Runx2 is a maternal determinant of dorsoventral patterning in zebrafish. Nature cell biology. 10(3):346-352
- Flores, M.V., Lam, E.Y., Crosier, P., and Crosier, K. (2006) A hierarchy of Runx transcription factors modulate the onset of chondrogenesis in craniofacial endochondral bones in zebrafish. Developmental Dynamics : an official publication of the American Association of Anatomists. 235(11):3166-3176
1 - 2 of 2
Show