Morpholino
MO2-foxc1a
- ID
- ZDB-MRPHLNO-061111-2
- Name
- MO2-foxc1a
- Previous Names
- None
- Target
- Sequence
-
5' - CCTGCATGACTGCTCTCCAAAACGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-foxc1a
No data available
Phenotype
Phenotype resulting from MO2-foxc1a
1 - 5 of 15 Show all
Phenotype of all Fish created by or utilizing MO2-foxc1a
1 - 5 of 89 Show all
Citations
- Chrystal, P.W., French, C.R., Jean, F., Havrylov, S., van Baarle, S., Peturson, A.M., Xu, P., Crump, J.G., Pilgrim, D.B., Lehmann, O.J., Waskiewicz, A.J. (2021) The Axenfeld-Rieger Syndrome Gene FOXC1 Contributes to Left-Right Patterning. Genes. 12(2):
- Umali, J., Hawkey-Noble, A., French, C.R. (2019) Loss of foxc1 in zebrafish reduces optic nerve size and cell number in the ganglion cell layer. Vision Research. 156:66-72
- Jang, I.H., Lu, Y.F., Zhao, L., Wenzel, P.L., Kume, T., Datta, S.M., Arora, N., Guiu, J., Lagha, M., Kim, P.G., Do, E.K., Kim, J.H., Schlaeger, T.M., Zon, L.I., Bigas, A., Burns, C.E., Daley, G.Q. (2015) Notch1 acts via Foxc2 to promote definitive hematopoiesis via effects on hemogenic endothelium. Blood. 125(9):1418-26
- Li, J., Yue, Y., Dong, X., Jia, W., Li, K., Liang, D., Dong, Z., Wang, X., Nan, X., Zhang, Q., Zhao, Q. (2015) Zebrafish foxc1a plays a crucial role in early somitogenesis by restricting the expression of aldh1a2 directly. The Journal of biological chemistry. 290(16):10216-28
- French, C.R., Seshadri, S., Destefano, A.L., Fornage, M., Arnold, C.R., Gage, P.J., Skarie, J.M., Dobyns, W.B., Millen, K.J., Liu, T., Dietz, W., Kume, T., Hofker, M., Emery, D.J., Childs, S.J., Waskiewicz, A.J., Lehmann, O.J. (2014) Mutation of FOXC1 and PITX2 induces cerebral small-vessel disease. J. Clin. Invest.. 124(11):4877-81
- He, B., Ebarasi, L., Zhao, Z., Guo, J., Ojala, J.R., Hultenby, K., De Val, S., Betsholtz, C., Tryggvason, K. (2014) Lmx1b and FoxC Combinatorially Regulate Podocin Expression in Podocytes. Journal of the American Society of Nephrology : JASN. 25(12):2764-77
- Veldman, M.B., and Lin, S. (2012) Etsrp/Etv2 Is Directly Regulated by Foxc1a/b in the Zebrafish Angioblast. Circulation research. 110(2):220-229
- Acharya, M., Huang, L., Fleisch, V.C., Allison, W.T., and Walter, M.A. (2011) A Complex Regulatory Network of Transcription Factors Critical for Ocular Development and Disease. Human molecular genetics. 20(8):1610-24
- Lupo, G., Gestri, G., O'Brien, M., Denton, R.M., Chandraratna, R.A., Ley, S.V., Harris, W.A., and Wilson, S.W. (2011) Retinoic acid receptor signaling regulates choroid fissure closure through independent mechanisms in the ventral optic cup and periocular mesenchyme. Proceedings of the National Academy of Sciences of the United States of America. 108(21):8698-8703
- Lee, H.C., Tseng, W.A., Lo, F.Y., Liu, T.M., and Tsai, H.J. (2009) FoxD5 mediates anterior-posterior polarity through upstream modulator Fgf signaling during zebrafish somitogenesis. Developmental Biology. 336(2):232-245
1 - 10 of 15
Show