Morpholino
MO1-rhoab
- ID
- ZDB-MRPHLNO-060713-1
- Name
- MO1-rhoab
- Previous Names
-
- rhoA MO1 (1)
- Target
- Sequence
-
5' - TCCGTCGCCTCTCTTATGTCCGATA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rhoab
No data available
Phenotype
Phenotype resulting from MO1-rhoab
1 - 5 of 36 Show all
Phenotype of all Fish created by or utilizing MO1-rhoab
1 - 5 of 37 Show all
Citations
- Marchesi, S., Montani, F., Deflorian, G., D'Antuono, R., Cuomo, A., Bologna, S., Mazzoccoli, C., Bonaldi, T., Di Fiore, P.P., Nicassio, F. (2014) DEPDC1B Coordinates De-adhesion Events and Cell-Cycle Progression at Mitosis. Developmental Cell. 31:420-433
- Castanon, I., Abrami, L., Holtzer, L., Heisenberg, C.P., van der Goot, F.G., and González-Gaitán, M. (2013) Anthrax toxin receptor 2a controls mitotic spindle positioning. Nature cell biology. 15(1):28-39
- Liu, L., Zhu, S., Gong, Z., and Low, B.C. (2008) K-ras/PI3K-Akt signaling is essential for zebrafish hematopoiesis and angiogenesis. PLoS One. 3(8):e2850
- Zhu, S., Korzh, V., Gong, Z., and Low, B.C. (2008) RhoA prevents apoptosis during zebrafish embryogenesis through activation of Mek/Erk pathway. Oncogene. 27(11):1580-1589
- Zhu, S., Liu, L., Korzh, V., Gong, Z., and Low, B.C. (2006) RhoA acts downstream of Wnt5 and Wnt11 to regulate convergence and extension movements by involving effectors Rho Kinase and Diaphanous: Use of zebrafish as an in vivo model for GTPase signaling. Cellular Signalling. 18(3):359-372
1 - 5 of 5
Show