Morpholino
MO1-tcf7l1a
- ID
- ZDB-MRPHLNO-060705-5
- Name
- MO1-tcf7l1a
- Previous Names
- Target
- Sequence
-
5' - CTCCGTTTAACTGAGGCATGTTGGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation blocking morpholino
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tcf7l1a
No data available
Phenotype
Phenotype resulting from MO1-tcf7l1a
1 - 5 of 15 Show all
Phenotype of all Fish created by or utilizing MO1-tcf7l1a
1 - 5 of 41 Show all
Citations
- Coppola, U., Saha, B., Kenney, J., Waxman, J.S. (2024) A Foxf1-Wnt-Nr2f1 cascade promotes atrial cardiomyocyte differentiation in zebrafish. PLoS Genetics. 20:e1011222e1011222
- He, M., Zhang, R., Jiao, S., Zhang, F., Ye, D., Wang, H., Sun, Y. (2020) Nanog safeguards early embryogenesis against global activation of maternal β-catenin activity by interfering with TCF factors. PLoS Biology. 18:e3000561
- Johansson, M., Giger, F.A., Fielding, T., Houart, C. (2019) Dkk1 Controls Cell-Cell Interaction through Regulation of Non-nuclear β-Catenin Pools. Developmental Cell. 51(6):775-786.e3
- Mandal, A., Holowiecki, A., Song, Y.C., Waxman, J.S. (2017) Wnt signaling balances specification of the cardiac and pharyngeal muscle fields. Mechanisms of Development. 143:32-41
- Lu, F.I., Sun, Y.H., Wei, C.Y., Thisse, C., Thisse, B. (2014) Tissue-specific derepression of TCF/LEF controls the activity of the Wnt/β-catenin pathway. Nature communications. 5:5368
- Sorrell, M.R., Dohn, T.E., D'Aniello, E., and Waxman, J.S. (2013) Tcf7l1 proteins cell autonomously restrict cardiomyocyte and promote endothelial specification in zebrafish. Developmental Biology. 380(2):199-210
- Shimizu, N., Kawakami, K., and Ishitani, T. (2012) Visualization and exploration of Tcf/Lef function using a highly responsive Wnt/beta-catenin signaling-reporter transgenic zebrafish. Developmental Biology. 370(1):71-85
- Kagermeier-Schenk, B., Wehner, D., Ozhan-Kizil, G., Yamamoto, H., Li, J., Kirchner, K., Hoffmann, C., Stern, P., Kikuchi, A., Schambony, A., and Weidinger, G. (2011) Waif1/5T4 Inhibits Wnt/β-Catenin Signaling and Activates Noncanonical Wnt Pathways by Modifying LRP6 Subcellular Localization. Developmental Cell. 21(6):1129-43
- Faro, A., Boj, S.F., Ambrósio, R., van den Broek, O., Korving, J., and Clevers, H. (2009) T-Cell Factor 4 (tcf7l2) Is the Main Effector of Wnt Signaling During Zebrafish Intestine Organogenesis. Zebrafish. 6(1):59-68
- Gribble, S.L., Kim, H.S., Bonner, J., Wang, X., and Dorsky, R.I. (2009) Tcf3 inhibits spinal cord neurogenesis by regulating sox4a expression. Development (Cambridge, England). 136(5):781-789
1 - 10 of 17
Show