Morpholino
MO2-cdx1a
- ID
- ZDB-MRPHLNO-060602-1
- Name
- MO2-cdx1a
- Previous Names
- None
- Target
- Sequence
-
5' - CAGCAGATAGCTCACGGACATTTTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This sequence differs by one bp from the published cdx1a sequence AB067733, which may be a polymorphism.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cdx1a
No data available
Phenotype
Phenotype resulting from MO2-cdx1a
No data available
Phenotype of all Fish created by or utilizing MO2-cdx1a
1 - 5 of 24 Show all
Citations
- Paik, E.J., Mahony, S., White, R.M., Price, E.N., Dibiase, A., Dorjsuren, B., Mosimann, C., Davidson, A.J., Gifford, D., and Zon, L.I. (2013) A cdx4-sall4 regulatory module controls the transition from mesoderm formation to embryonic hematopoiesis. Stem Cell Reports. 1(5):425-436
- Lengerke, C., Wingert, R., Beeretz, M., Grauer, M., Schmidt, A.G., Konantz, M., Daley, G.Q., and Davidson, A.J. (2011) Interactions between Cdx genes and retinoic acid modulate early cardiogenesis. Developmental Biology. 354(1):134-142
- Pillay, L.M., Forrester, A.M., Erickson, T., Berman, J.N., and Waskiewicz, A.J. (2010) The Hox cofactors Meis1 and Pbx act upstream of gata1 to regulate primitive hematopoiesis. Developmental Biology. 340(2):306-317
- Flores, M.V., Hall, C.J., Davidson, A.J., Singh, P.P., Mahagaonkar, A.A., Zon, L.I., Crosier, K.E., and Crosier, P.S. (2008) Intestinal Differentiation in Zebrafish Requires Cdx1b, a Functional Equivalent of Mammalian Cdx2. Gastroenterology. 135(5):1665-1675
- Wingert, R.A., Selleck, R., Yu, J., Song, H.D., Chen, Z., Song, A., Zhou, Y., Thisse, B., Thisse, C., McMahon, A.P., and Davidson, A.J. (2007) The cdx Genes and Retinoic Acid Control the Positioning and Segmentation of the Zebrafish Pronephros. PLoS Genetics. 3(10):1922-1938
- Davidson, A.J., and Zon, L.I. (2006) The caudal-related homeobox genes cdx1a and cdx4 act redundantly to regulate hox gene expression and the formation of putative hematopoietic stem cells during zebrafish embryogenesis. Developmental Biology. 292(2):506-518
1 - 6 of 6
Show