Morpholino
MO1-gata5
- ID
- ZDB-MRPHLNO-060522-2
- Name
- MO1-gata5
- Previous Names
- None
- Target
- Sequence
-
5' - TGTTAAGATTTTTACCTATACTGGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The sequence in Trinh et al. 2005 (ZDB-PUB-060517-17) contains a typo. The corrected sequence is displayed on this page.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gata5
No data available
Phenotype
Phenotype resulting from MO1-gata5
1 - 5 of 17 Show all
Phenotype of all Fish created by or utilizing MO1-gata5
1 - 5 of 72 Show all
Citations
- Song, M., Yuan, X., Racioppi, C., Leslie, M., Stutt, N., Aleksandrova, A., Christiaen, L., Wilson, M.D., Scott, I.C. (2022) GATA4/5/6 family transcription factors are conserved determinants of cardiac versus pharyngeal mesoderm fate. Science advances. 8:eabg0834
- Jia, W., Liang, D., Li, N., Liu, M., Dong, Z., Li, J., Dong, X., Yue, Y., Hu, P., Yao, J., Zhao, Q. (2018) Zebrafish microRNA miR-210-5p inhibits primitive myelopoiesis by silencing foxj1b and slc3a2a mRNAs downstream of gata4/5/6 transcription factor genes. The Journal of biological chemistry. 294(8):2732-2743
- Yuan, X., Song, M., Devine, P., Bruneau, B.G., Scott, I.C., Wilson, M.D. (2018) Heart enhancers with deeply conserved regulatory activity are established early in zebrafish development. Nature communications. 9:4977
- Hempel, M., Casar Tena, T., Diehl, T., Burczyk, M.S., Strom, T.M., Kubisch, C., Philipp, M., Lessel, D. (2017) Compound heterozygous GATA5 mutations in a girl with hydrops fetalis, congenital heart defects and genital anomalies. Human genetics. 136(3):339-346
- Wen, B., Yuan, H., Liu, X., Wang, H., Chen, S., Chen, Z., de The, H., Zhou, J., Zhu, J. (2017) GATA5 SUMOylation is indispensable for zebrafish cardiac development. Biochimica et biophysica acta. 1861(7):1691-1701
- Lin, C.Y., Huang, C.C., Wang, W.D., Hsiao, C.D., Cheng, C.F., Wu, Y.T., Lu, Y.F., and Hwang, S.P. (2013) Low temperature mitigates cardia bifida in zebrafish embryos. PLoS One. 8(7):e69788
- Liang, D., Jia, W., Li, J., Li, K., and Zhao, Q. (2012) Retinoic Acid signaling plays a restrictive role in zebrafish primitive myelopoiesis. PLoS One. 7(2):e30865
- Lou, X., Deshwar, A.R., Crump, J.G., and Scott, I.C. (2011) Smarcd3b and Gata5 promote a cardiac progenitor fate in the zebrafish embryo. Development (Cambridge, England). 138(15):3113-23
- Park, J.S., Kim, H.S., Kim, J.D., Seo, J., Chung, K.S., Lee, H.S., Huh, T.L., Jo, I., and Kim, Y.O. (2009) Isolation of a ventricle-specific promoter for the zebrafish ventricular myosin heavy chain (vmhc) gene and its regulation by GATA factors during embryonic heart development. Developmental Dynamics : an official publication of the American Association of Anatomists. 238(6):1574-1581
- Peterkin, T., Gibson, A., and Patient, R. (2009) Common genetic control of haemangioblast and cardiac development in zebrafish. Development (Cambridge, England). 136(9):1465-1474
1 - 10 of 14
Show