Morpholino
MO1-flt4
- ID
- ZDB-MRPHLNO-060515-1
- Name
- MO1-flt4
- Previous Names
-
- Flt4 SD1 MO (1)
- Target
- Sequence
-
5' - TTAGGAAAATGCGTTCTCACCTGAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Overlaps the exon 1 splice donor site.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-flt4
No data available
Phenotype
Phenotype resulting from MO1-flt4
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO1-flt4
1 - 5 of 13 Show all
Citations
- Chou, C.W., Hsu, H.C., You, M.S., Lin, J., Liu, Y.W. (2016) The endoderm indirectly influences morphogenetic movements of the zebrafish head kidney through the posterior cardinal vein and VegfC. Scientific Reports. 6:30677
- Baeyens, N., Nicoli, S., Coon, B.G., Ross, T.D., Van den Dries, K., Han, J., Lauridsen, H.M., Mejean, C.O., Eichmann, A., Thomas, J.L., Humphrey, J.D., Schwartz, M.A. (2015) Vascular remodeling is governed by a VEGFR3-dependent fluid shear stress set point. eLIFE. 4
- Yokota, Y., Nakajima, H., Wakayama, Y., Muto, A., Kawakami, K., Fukuhara, S., Mochizuki, N. (2015) Endothelial Ca(2+) oscillations reflect VEGFR signaling-regulated angiogenic capacity in vivo. eLIFE. 4
- Kwon, H.B., Fukuhara, S., Asakawa, K., Ando, K., Kashiwada, T., Kawakami, K., Hibi, M., Kwon, Y.G., Kim, K.W., Alitalo, K., and Mochizuki, N. (2013) The parallel growth of motoneuron axons with the dorsal aorta depends on Vegfc/Vegfr3 signaling in zebrafish. Development (Cambridge, England). 140(19):4081-4090
- Herbert, S.P., Cheung, J.Y., and Stainier, D.Y. (2012) Determination of Endothelial Stalk versus Tip Cell Potential during Angiogenesis by H2.0-like Homeobox-1. Current biology : CB. 22(19):1789-1794
- Nicoli, S., Knyphausen, C.P., Zhu, L.J., Lakshmanan, A., and Lawson, N.D. (2012) miR-221 Is Required for Endothelial Tip Cell Behaviors during Vascular Development. Developmental Cell. 22(2):418-429
- Gore, A.V., Swift, M.R., Cha, Y.R., Lo, B., McKinney, M.C., Li, W., Castranova, D., Davis, A., Mukouyama, Y.S., and Weinstein, B.M. (2011) Rspo1/Wnt signaling promotes angiogenesis via Vegfc/Vegfr3. Development (Cambridge, England). 138(22):4875-4886
- Fukui, H., Hanaoka, R., and Kawahara, A. (2009) Noncanonical Activity of Seryl-tRNA Synthetase Is Involved in Vascular Development. Circulation research. 104(11):1253-1259
- Herbert, S.P., Huisken, J., Kim, T.N., Feldman, M.E., Houseman, B.T., Wang, R.A., Shokat, K.M., and Stainier, D.Y. (2009) Arterial-venous segregation by selective cell sprouting: an alternative mode of blood vessel formation. Science (New York, N.Y.). 326(5950):294-298
- Siekmann, A.F., and Lawson, N.D. (2007) Notch signalling limits angiogenic cell behaviour in developing zebrafish arteries. Nature. 445(7129):781-784
1 - 10 of 11
Show