Morpholino
MO1-dmd
- ID
- ZDB-MRPHLNO-060220-1
- Name
- MO1-dmd
- Previous Names
- None
- Target
- Sequence
-
5' - TTGAGTCCTTTAATCCTACAATTTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This morpholino has a 1 bp mismatch to Ensembl sequence, which may be due to a polymorphism. Correspondence with author Guyon indicates that the published sequence of the morpholino is correct and that it matches the sequence of their cDNA.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dmd
No data available
Phenotype
Phenotype resulting from MO1-dmd
Phenotype | Fish | Figures |
---|---|---|
muscle broken, abnormal | zf13Tg + MO1-dmd |
Fig. 1 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-dmd
1 - 5 of 34 Show all
Citations
- Spreafico, M., Cafora, M., Bragato, C., Capitanio, D., Marasca, F., Bodega, B., De Palma, C., Mora, M., Gelfi, C., Marozzi, A., Pistocchi, A. (2021) Targeting HDAC8 to ameliorate skeletal muscle differentiation in Duchenne muscular dystrophy. Pharmacological research. 170:105750
- Bajanca, F., Vandel, L. (2017) Epigenetic Regulators Modulate Muscle Damage in Duchenne Muscular Dystrophy Model. PLoS Currents. 9
- Ruf-Zamojski, F., Trivedi, V., Fraser, S.E., Trinh, L.A. (2015) Spatio-Temporal Differences in Dystrophin Dynamics at mRNA and Protein Levels Revealed by a Novel FlipTrap Line. PLoS One. 10:e0128944
- Johnson, N.M., Farr, G.H., and Maves, L. (2013) The HDAC Inhibitor TSA Ameliorates a Zebrafish Model of Duchenne Muscular Dystrophy. PLoS Currents. 5:157-71
- Kawahara, G., Karpf, J.A., Myers, J.A., Alexander, M.S., Guyon, J.R., and Kunkel, L.M. (2011) Drug screening in a zebrafish model of Duchenne muscular dystrophy. Proceedings of the National Academy of Sciences of the United States of America. 108(13):5331-6
- Etard, C., Behra, M., Ertzer, R., Fischer, N., Jesuthasan, S., Blader, P., Geisler, R., and Strähle, U. (2005) Mutation in the delta-subunit of the nAChR suppresses the muscle defects caused by lack of Dystrophin. Developmental Dynamics : an official publication of the American Association of Anatomists. 234(4):1016-1025
- Guyon, J.R., Mosley, A.N., Zhou, Y., O'Brien, K.F., Sheng, X., Chiang, K., Davidson, A.J., Volinski, J.M., Zon, L.I., and Kunkel, L.M. (2003) The dystrophin associated protein complex in zebrafish. Human molecular genetics. 12(6):601-615
1 - 7 of 7
Show