Morpholino
MO2-lef1
- ID
- ZDB-MRPHLNO-060214-6
- Name
- MO2-lef1
- Previous Names
- None
- Target
- Sequence
-
5' - ACTGCCTGGATGAAACACTTACATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice blocker
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-lef1
No data available
Phenotype
Phenotype resulting from MO2-lef1
1 - 5 of 17 Show all
Phenotype of all Fish created by or utilizing MO2-lef1
1 - 5 of 21 Show all
Citations
- Zhu, P., Xu, X., Lin, X. (2015) Both ciliary and non-ciliary functions of Foxj1a confer Wnt/β-catenin signaling in zebrafish left-right patterning. Biology Open. 4(11):1376-86
- Ota, S., Ishitani, S., Shimizu, N., Matsumoto, K., Itoh, M., and Ishitani, T. (2012) NLK positively regulates Wnt/beta-catenin signalling by phosphorylating LEF1 in neural progenitor cells. The EMBO journal. 31(8):1904-1915
- Rai, K., Jafri, I.F., Chidester, S., James, S.R., Karpf, A.R., Cairns, B.R., and Jones, D.A. (2010) Dnmt3 and G9a cooperate for tissue-specific development in zebrafish. The Journal of biological chemistry. 285(6):4110-4121
- Rai, K., Sarkar, S., Broadbent, T.J., Voas, M., Grossmann, K.F., Nadauld, L.D., Dehghanizadeh, S., Hagos, F.T., Li, Y., Toth, R.K., Chidester, S., Bahr, T.M., Johnson, W.E., Sklow, B., Burt, R., Cairns, B.R., and Jones, D.A. (2010) DNA demethylase activity maintains intestinal cells in an undifferentiated state following loss of APC. Cell. 142(6):930-942
- Danesin, C., Peres, J.N., Johansson, M., Snowden, V., Cording, A., Papalopulu, N., and Houart, C. (2009) Integration of telencephalic Wnt and hedgehog signaling center activities by Foxg1. Developmental Cell. 16(4):576-587
- Bonkowsky, J.L., Wang, X., Fujimoto, E., Lee, J.E., Chien, C.B., and Dorsky, R.I. (2008) Domain-specific regulation of foxP2 CNS expression by lef1. BMC Developmental Biology. 8:103
- Russek-Blum, N., Gutnick, A., Nabel-Rosen, H., Blechman, J., Staudt, N., Dorsky, R.I., Houart, C., and Levkowitz, G. (2008) Dopaminergic neuronal cluster size is determined during early forebrain patterning. Development (Cambridge, England). 135(20):3401-3413
- Nyholm, M.K., Wu, S.F., Dorsky, R.I., and Grinblat, Y. (2007) The zebrafish zic2a-zic5 gene pair acts downstream of canonical Wnt signaling to control cell proliferation in the developing tectum. Development (Cambridge, England). 134(4):735-746
- Lee, J.E., Wu, S.F., Goering, L.M., and Dorsky, R.I. (2006) Canonical Wnt signaling through Lef1 is required for hypothalamic neurogenesis. Development (Cambridge, England). 133(22):4451-4461
- Ishitani, T., Matsumoto, K., Chitnis, A.B., and Itoh, M. (2005) Nrarp functions to modulate neural-crest-cell differentiation by regulating LEF1 protein stability. Nature cell biology. 7(11):1106-1112
1 - 10 of 10
Show