Morpholino
MO4-runx1
- ID
- ZDB-MRPHLNO-060207-1
- Name
- MO4-runx1
- Previous Names
-
- runx1-MO1 (1)
- Target
- Sequence
-
5' - TGGCGTCCCAAAGAAAAACCATTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-runx1
No data available
Phenotype
Phenotype resulting from MO4-runx1
Phenotype | Fish | Figures |
---|---|---|
cranium shape, abnormal | WT + MO4-runx1 |
Fig. 4 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO4-runx1
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
cranium shape, abnormal | WT + MO4-runx1 | standard conditions |
Fig. 4 ![]() |
1 - 1 of 1
Citations
- Kitaguchi, T., Kawakami, K., and Kawahara, A. (2009) Transcriptional regulation of a myeloid-lineage specific gene lysozyme C during zebrafish myelopoiesis. Mechanisms of Development. 126(5-6):314-323
- Flores, M.V., Lam, E.Y., Crosier, P., and Crosier, K. (2006) A hierarchy of Runx transcription factors modulate the onset of chondrogenesis in craniofacial endochondral bones in zebrafish. Developmental Dynamics : an official publication of the American Association of Anatomists. 235(11):3166-3176
- Kalev-Zylinska, M.L., Horsfield, J.A., Flores, M.V.C., Postlethwait, J.H., Vitas, M.R., Baas, A.M., Crosier, P.S., and Crosier, K.E. (2002) Runx1 is required for zebrafish blood and vessel development and expression of a human RUNX1-CBF2T1 transgene advances a model for studies of leukemogenesis. Development (Cambridge, England). 129(8):2015-2030
1 - 3 of 3
Show