Morpholino
MO1-utp25
- ID
- ZDB-MRPHLNO-060104-1
- Name
- MO1-utp25
- Previous Names
-
- def-MO (1)
- MO1-def
- MO1-diexf
- Target
- Sequence
-
5' - ATGAATATAATGACTTACCAAGCGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-utp25
No data available
Phenotype
Phenotype resulting from MO1-utp25
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-utp25
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| exocrine pancreas hypoplastic, abnormal | WT + MO1-utp25 + MO6-tp53 | standard conditions |
Fig. 5
from Chen et al., 2009 |
| intestine hypoplastic, abnormal | WT + MO1-utp25 + MO6-tp53 | standard conditions |
Fig. 5
from Chen et al., 2009 |
1 - 2 of 2
Citations
- Guan, Y., Zhu, Q., Huang, D., Zhao, S., Jan Lo, L., Peng, J. (2015) An equation to estimate the difference between theoretically predicted and SDS PAGE-displayed molecular weights for an acidic peptide. Scientific Reports. 5:13370
- Shi, H., Tao, T., Huang, D., Ou, Z., Chen, J., Peng, J. (2015) A naturally occurring 4-bp deletion in the intron 4 of p53 creates a spectrum of novel p53 isoforms with anti-apoptosis function. Nucleic acids research. 43(2):1035-43
- Tao, T., Shi, H., Guan, Y., Huang, D., Chen, Y., Lane, D.P., Chen, J., and Peng, J. (2013) Def defines a conserved nucleolar pathway that leads p53 to proteasome-independent degradation. Cell Research. 23(5):620-634
- Chen, J., Ng, S.M., Chang, C., Zhang, Z., Bourdon, J.C., Lane, D.P., and Peng, J. (2009) p53 Isoform delta113p53 is a p53 target gene that antagonizes p53 apoptotic activity via BclxL activation in zebrafish. Genes & Development. 23(3):278-290
- Chen, J., Ruan, H., Ng, S.M., Gao, C., Soo, H.M., Wu, W., Zhang, Z., Wen, Z., Lane, D.P., and Peng, J. (2005) Loss of function of def selectively up-regulates {Delta}113p53 expression to arrest expansion growth of digestive organs in zebrafish. Genes & Development. 19(23):2900-2911
1 - 5 of 5
Show